TIMP-4/TIMP4 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10412-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TIMP-4/TIMP4 Reagents
CRO Services
Product recommended

All TIMP-4/TIMP4 Reagents
TIMP-4/TIMP4 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
675 bp
Description
Full length Clone DNA of Human TIMP metallopeptidase inhibitor 4 (TIMP4) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TIMP-4/TIMP4 Background Information
Full Name
TIMP metallopeptidase inhibitor 4

TIMP-4/TIMP4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TIMP-4/TIMP4 cDNA ORF Clone in Cloning Vector, Mouse MG51170-G
TIMP-4/TIMP4 cDNA ORF Clone, Mouse, untagged MG51170-UT
TIMP-4/TIMP4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51170-ACG
TIMP-4/TIMP4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51170-ACGLN
TIMP-4/TIMP4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51170-ACR
TIMP-4/TIMP4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51170-CF
TIMP-4/TIMP4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51170-NF
TIMP-4/TIMP4 cDNA ORF Clone, Mouse, C-His tag MG51170-CH
TIMP-4/TIMP4 cDNA ORF Clone, Mouse, N-His tag MG51170-NH
TIMP-4/TIMP4 cDNA ORF Clone, Mouse, C-HA tag MG51170-CY
TIMP-4/TIMP4 cDNA ORF Clone, Mouse, N-HA tag MG51170-NY
TIMP-4/TIMP4 cDNA ORF Clone, Mouse, C-Myc tag MG51170-CM
TIMP-4/TIMP4 cDNA ORF Clone, Mouse, N-Myc tag MG51170-NM

TIMP-4/TIMP4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TIMP-4/TIMP4 cDNA ORF Clone in Cloning Vector, Human HG10412-M
TIMP-4/TIMP4 cDNA ORF Clone, Human, untagged HG10412-UT
TIMP-4/TIMP4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10412-ACG
TIMP-4/TIMP4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10412-ACGLN
TIMP-4/TIMP4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10412-ACR
TIMP-4/TIMP4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10412-NF
TIMP-4/TIMP4 cDNA ORF Clone, Human, C-His tag HG10412-CH
TIMP-4/TIMP4 cDNA ORF Clone, Human, N-His tag HG10412-NH
TIMP-4/TIMP4 cDNA ORF Clone, Human, C-HA tag HG10412-CY
TIMP-4/TIMP4 cDNA ORF Clone, Human, N-HA tag HG10412-NY
TIMP-4/TIMP4 cDNA ORF Clone, Human, C-Myc tag HG10412-CM
TIMP-4/TIMP4 cDNA ORF Clone, Human, N-Myc tag HG10412-NM
TIMP-4/TIMP4 qPCR Primer Pairs, Human HP100442
info info
添加购物车成功! 添加购物车失败!