TIMP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10396-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TIMP2 Reagents
CRO Services
Product recommended

All TIMP2 Reagents
TIMP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
702 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human TIMP metallopeptidase inhibitor 2 (TIMP2) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
HindIII + XbaI(6kb+0.7kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
TIMP2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TIMP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5619
Human TIMP-2/TIMP2 Gene Expression validated Image 16140
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
TIMP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CSC-21K cDNA ORF Clone, Human;DDC8 cDNA ORF Clone, Human
TIMP2 Background Information

Tissue inhibitors of metalloproteinases (TIMP) family are natural inhibitors of the matrix metalloproteinases (MMPs), the zinc enzymes involved in extracellular matrix maintenance and remodeling. The TIMP family encompasses four members (TIMP1-4), and they inhibit most MMPs by forming non-covalent binary complex. TIMP2 is a 22 kDa non N-glycosylated protein expressed by a variety of cell types, and plays a unique role among TIMP family members owing to its functions to regulate cellular responses to growth factors. Findings establish an unexpected, MMP-independent mechanism for TIMP2 inhibition of endothelial cell proliferation in vitro and reveal an important component of the antiangiogenic effect of TIMP2 in vivo. TIMP-2 thus is critical to the maintenance of tissue homeostasis and is involved in the regulation of tumor microenvironment.

Full Name
TIMP metallopeptidase inhibitor 2
References
  • Stetler-Stevenson, W.G. et al., 1992, Matrix. Suppl.1: 299-306.
  • Stetler-Stevenson, W.G. et al., 2005, Trends. Mol. Med. 11: 97-103.
  • Seo, D.W. et al., 2003, Cell. 114: 171-180.
  • TIMP2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TIMP2 cDNA ORF Clone in Cloning Vector, Mouse MG50941-G
    TIMP2 cDNA ORF Clone, Mouse, untagged MG50941-UT
    TIMP2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50941-ACGLN
    TIMP2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50941-ACG
    TIMP2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50941-ACR
    TIMP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50941-CF
    TIMP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50941-NF
    TIMP2 cDNA ORF Clone, Mouse, C-His tag MG50941-CH
    TIMP2 cDNA ORF Clone, Mouse, N-His tag MG50941-NH
    TIMP2 cDNA ORF Clone, Mouse, C-HA tag MG50941-CY
    TIMP2 cDNA ORF Clone, Mouse, N-HA tag MG50941-NY
    TIMP2 cDNA ORF Clone, Mouse, C-Myc tag MG50941-CM
    TIMP2 cDNA ORF Clone, Mouse, N-Myc tag MG50941-NM
    TIMP2 qPCR Primer Pairs, Mouse MP200910

    TIMP2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TIMP2 cDNA ORF Clone in Cloning Vector, Human HG10396-M
    TIMP2 cDNA ORF Clone, Human, untagged HG10396-UT
    TIMP2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10396-ACGLN
    TIMP2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10396-ACG
    TIMP2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10396-ACR
    TIMP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10396-NF
    TIMP2 cDNA ORF Clone, Human, C-His tag HG10396-CH
    TIMP2 cDNA ORF Clone, Human, N-His tag HG10396-NH
    TIMP2 cDNA ORF Clone, Human, C-HA tag HG10396-CY
    TIMP2 cDNA ORF Clone, Human, N-HA tag HG10396-NY
    TIMP2 cDNA ORF Clone, Human, C-Myc tag HG10396-CM
    TIMP2 cDNA ORF Clone, Human, N-Myc tag HG10396-NM
    TIMP2 qPCR Primer Pairs, Human HP100428
    info info
    添加购物车成功! 添加购物车失败!