TIMM21 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG14649-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TIMM21 Reagents
CRO Services
Product recommended

All TIMM21 Reagents
TIMM21 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
747 bp
Description
Full length Clone DNA of Human translocase of inner mitochondrial membrane 21 homolog (yeast) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TIMM21 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
C18orf55 cDNA ORF Clone, Human;HSPC154 cDNA ORF Clone, Human;TIM21 cDNA ORF Clone, Human
TIMM21 Background Information
Full Name
translocase of inner mitochondrial membrane 21 homolog (yeast)

TIMM21 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
TIMM21 cDNA ORF Clone in Cloning Vector, Rabbit TG65108-G
TIMM21 cDNA ORF Clone, Rabbit, untagged TG65108-UT
TIMM21 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65108-ACG
TIMM21 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65108-ANG
TIMM21 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65108-ACR
TIMM21 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65108-ANR
TIMM21 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65108-CF
TIMM21 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65108-NF
TIMM21 cDNA ORF Clone, Rabbit, C-His tag TG65108-CH
TIMM21 cDNA ORF Clone, Rabbit, N-His tag TG65108-NH
TIMM21 cDNA ORF Clone, Rabbit, C-HA tag TG65108-CY
TIMM21 cDNA ORF Clone, Rabbit, N-HA tag TG65108-NY
TIMM21 cDNA ORF Clone, Rabbit, C-Myc tag TG65108-CM
TIMM21 cDNA ORF Clone, Rabbit, N-Myc tag TG65108-NM

TIMM21 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TIMM21 cDNA ORF Clone in Cloning Vector, Rat RG89993-U
TIMM21 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG89993-ACGLN

TIMM21 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TIMM21 cDNA ORF Clone in Cloning Vector, Mouse MG51857-G
TIMM21 cDNA ORF Clone, Mouse, untagged MG51857-UT
TIMM21 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51857-ACG
TIMM21 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51857-ACGLN
TIMM21 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51857-ANG
TIMM21 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51857-ACR
TIMM21 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51857-ANR
TIMM21 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51857-CF
TIMM21 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51857-NF
TIMM21 cDNA ORF Clone, Mouse, C-His tag MG51857-CH
TIMM21 cDNA ORF Clone, Mouse, N-His tag MG51857-NH
TIMM21 cDNA ORF Clone, Mouse, C-HA tag MG51857-CY
TIMM21 cDNA ORF Clone, Mouse, N-HA tag MG51857-NY
TIMM21 cDNA ORF Clone, Mouse, C-Myc tag MG51857-CM
TIMM21 cDNA ORF Clone, Mouse, N-Myc tag MG51857-NM
TIMM21 qPCR Primer Pairs, Mouse MP201730

TIMM21 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TIMM21 cDNA ORF Clone in Cloning Vector, Human HG14649-G
TIMM21 cDNA ORF Clone, Human, untagged HG14649-UT
TIMM21 cDNA ORF Clone, Human, C-GFPSpark® tag HG14649-ACG
TIMM21 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14649-ACGLN
TIMM21 cDNA ORF Clone, Human, C-OFPSpark® tag HG14649-ACR
TIMM21 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14649-CF
TIMM21 cDNA ORF Clone, Human, C-His tag HG14649-CH
TIMM21 cDNA ORF Clone, Human, N-His tag HG14649-NH
TIMM21 cDNA ORF Clone, Human, C-HA tag HG14649-CY
TIMM21 cDNA ORF Clone, Human, N-HA tag HG14649-NY
TIMM21 cDNA ORF Clone, Human, C-Myc tag HG14649-CM
TIMM21 cDNA ORF Clone, Human, N-Myc tag HG14649-NM
TIMM21 qPCR Primer Pairs, Human HP103283
info info
添加购物车成功! 添加购物车失败!