Tim4 cDNA ORF Clone, Human, C-HA tag

Cat: HG12161-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Tim4 Reagents
CRO Services
Product recommended

All Tim4 Reagents
Tim4 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1137 bp
Description
Full length Clone DNA of Human T-cell immunoglobulin and mucin domain containing with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Tim4 cDNA ORF Clone, Human, C-HA tag Alternative Names
SMUCKLER cDNA ORF Clone, Human;TIM4 cDNA ORF Clone, Human
Tim4 Background Information

A type I transmembrane protein called TIM4 (T-cell immunoglobulin- and mucin-domain-containing molecule; also known as TIMD4), which belongs to the immunoglobulin superfamily and TIM family. TIM4 is involved in regulating T-cell proliferation and lymphotoxin signaling. It is a ligand for HAVCR1/TIMD1. Recent reports indicate that dendritic cell (DC)-derived T-cell immunoglobulin and mucin domain molecule (TIM)-4, which is expressed on dendritic cells and macrophages, plays an important role in the initiation of T(H)2 polarization. TIM4 bound apoptotic cells by recognizing phosphatidylserine via its immunoglobulin domain. The expression of TIM4 in fibroblasts enhanced their ability to engulf apoptotic cells. TIM4 is phosphatidylserine receptor for the engulfment of apoptotic cells, and may also be involved in intercellular signalling in which exosomes are involved. Modulation of TIM4 production in dendritic cells (DCs) represents a novel therapeutic approach for the treatment of peanut allergy. The interaction of TIM1/TIM4 played a critical role in sustaining the polarization status of Th2 cells in allergic rhinitis (AR) patients. Cross-linking FcgammaRI by antigen/IgG complexes increased the production of TIM4 by dendritic cells via upregulating tumor necrosis factor-alpha in DCs. Specific immunotherapy (SIT) suppresses the skewed Th2 responses via disrupting the interaction of TIM1/TIM4 in antigen-specific Th2 cells.

Full Name
T-cell immunoglobulin and mucin domain containing 4
References
  • Miyanishi M, et al. (2007) Identification of Tim4 as a phosphatidylserine receptor. Nature. 450(7168): 435-9.
  • Feng BS, et al. (2008) Disruption of T-cell immunoglobulin and mucin domain molecule (TIM)-1/TIM4 interaction as a therapeutic strategy in a dendritic cell-induced peanut allergy model. J Allergy Clin Immunol. 122(1): 55-61.
  • Cai PC, et al. (2009) Association of TIM4 promoter polymorphism -1419GA with childhood asthma in a Chinese Han population. Tissue Antigens. 74(1): 11-6.
  • Zhao CQ, et al. (2010) Specific immunotherapy suppresses Th2 responses via modulating TIM1/TIM4 interaction on dendritic cells. Allergy. 65(8): 986-95.
  • Tim4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Tim4 cDNA ORF Clone in Cloning Vector, Mouse MG50388-M
    Tim4 cDNA ORF Clone, Mouse, untagged MG50388-UT
    Tim4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50388-ACG
    Tim4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50388-ACGLN
    Tim4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50388-ACR
    Tim4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50388-CF
    Tim4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50388-NF
    Tim4 cDNA ORF Clone, Mouse, C-His tag MG50388-CH
    Tim4 cDNA ORF Clone, Mouse, N-His tag MG50388-NH
    Tim4 cDNA ORF Clone, Mouse, C-HA tag MG50388-CY
    Tim4 cDNA ORF Clone, Mouse, N-HA tag MG50388-NY
    Tim4 cDNA ORF Clone, Mouse, C-Myc tag MG50388-CM
    Tim4 cDNA ORF Clone, Mouse, N-Myc tag MG50388-NM
    Tim4 qPCR Primer Pairs, Mouse MP200407

    Tim4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Tim4 cDNA ORF Clone in Cloning Vector, Human HG12161-G
    Tim4 cDNA ORF Clone, Human, untagged HG12161-UT
    Tim4 cDNA ORF Clone, Human, C-GFPSpark® tag HG12161-ACG
    Tim4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12161-ACGLN
    Tim4 cDNA ORF Clone, Human, C-OFPSpark® tag HG12161-ACR
    Tim4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12161-CF
    Tim4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12161-NF
    Tim4 cDNA ORF Clone, Human, C-His tag HG12161-CH
    Tim4 cDNA ORF Clone, Human, N-His tag HG12161-NH
    Tim4 cDNA ORF Clone, Human, N-HA tag HG12161-NY
    Tim4 cDNA ORF Clone, Human, C-Myc tag HG12161-CM
    Tim4 cDNA ORF Clone, Human, N-Myc tag HG12161-NM
    Tim4 qPCR Primer Pairs, Human HP101795
    info info
    添加购物车成功! 添加购物车失败!