Quick Order

Human TIGIT/VSTM3 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human TIGIT cDNA Clone Product Information
NCBI RefSeq:NM_173799.2
RefSeq ORF Size:735bp
cDNA Description:Full length Clone DNA of Homo sapiens T cell immunoreceptor with Ig and ITIM domains with N terminal Myc tag.
Gene Synonym:VSIG9, VSTM3, FLJ39873, DKFZp667A205
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:pCMV3-Myc-TIGIT
Restriction Site:KpnI+XbaI (6kb+0.77kb)
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 309t/c not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human TIGIT Gene Plasmid Map
Human TIGIT / VSTM3 ORF mammalian expression plasmid, N-Myc tag
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

TIGIT, also known as V-set and transmembrane domain-containing protein 3 (VSTM3) or V-set and immunoglobulin domain-containing protein 9 (VSIG9) is a new surface protein containing an immunoglobulin variable domain, a transmembrane domain and an immunoreceptor tyrosine-based inhibitory motif (ITIM). TIGIT is expressed on regulatory, memory, activated T cells and NK cells. It binds PVR with high affinity, and PVRL2 with lower affinity, but not PVRL3. Knockdown of TIGIT with siRNA in human memory T cells did not affect T cell responses, however, TIGIT inhibits NK cytotoxicity directly through its ITIM. TIGIT suppresses T cell activation by promoting the generation of mature immunoregulatory dendritic cells. The binding of PVR to TIGIT on human dendritic cells enhanced the production of IL-10 and diminished the production of IL-12p40. In addition, TIGIT counter inhibits the NK-mediated killing of tumor cells and protects normal cells from NK-mediated cytotoxicity thus providing an "alternative self" mechanism for MHC class I inhibition.

Size / Price
Catalog: HG10917-NM
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
  • Human TIGIT / VSTM3 ORF mammalian expression plasmid, N-Myc tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"