Quick Order

Human TGFBI Gene ORF cDNA clone expression plasmid, N-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Human TGFBI cDNA Clone Product Information
    NCBI RefSeq:NM_000358.2
    RefSeq ORF Size:2052bp
    cDNA Description:Full length Clone DNA of Homo sapiens transforming growth factor, beta-induced, 68kDa with N terminal Flag tag.
    Gene Synonym:CSD, CDB1, CDG2, CSD1, CSD2, CSD3, EBMD, LCD1, BIGH3, CDGG1
    Species:Human
    Vector:pCMV3-SP-N-FLAG
    Plasmid:
    Restriction Site:
    Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TGFBI qPCR primers for gene expression analysis, HP100577 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    Background

    TGFBI is an RGD-containing protein that binds to type I, II and IV collagens. The RGD motif is found in many extracellular matrix proteins modulating cell adhesion and serves as a ligand recognition sequence for several integrins. TGFBI plays a role in cell-collagen interactions and may be involved in endochondrial bone formation in cartilage. TGFBI is induced by transforming growth factor-beta and acts to inhibit cell adhesion. Mutations in TGFBI are associated with multiple types of corneal dystrophy. TGFBI can bind to type I, II, and IV collagens. This adhesion protein may play an important role in cell-collagen interactions. In cartilage, TGFBI may be involved in endochondral bone formation. Loss of the TGFBI is sufficient to induce specific resistance.

    References
  • Kannabiran C, et al. (2006) TGFBI gene mutations in corneal dystrophies. Hum Mutat. 27(7): 615-25.
  • Size / Price
    Catalog: HG10569-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"