TDO2 cDNA ORF Clone, Human, N-His tag

Cat: HG13215-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TDO2 Reagents
CRO Services
Product recommended

All TDO2 Reagents
TDO2 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1266 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human tryptophan 2,3-dioxygenase with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Restriction Sites
KpnI + XbaI(6kb+1.27kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
TDO2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TDO2 cDNA ORF Clone, Human, N-His tag Validated Images
Ferret TNF-alpha/TNFA/TNFSF2 Gene Plasmid Map 5629
TDO2 cDNA ORF Clone, Human, N-His tag Alternative Names
TDO cDNA ORF Clone, Human;TO cDNA ORF Clone, Human;TPH2 cDNA ORF Clone, Human;TRPO cDNA ORF Clone, Human
TDO2 Background Information

TDO2 gene encodes a heme enzyme that plays a critical role in tryptophan metabolism by catalyzing the first and rate-limiting step of the kynurenine pathway. Increased activity of the encoded protein and subsequent kynurenine production may also play a role in cancer through the suppression of antitumor immune responses, and single nucleotide polymorphisms in this gene may be associated with autism.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
tryptophan 2,3-dioxygenase
References
  • Wu W, Nicolazzo JA, Wen L, et al. Expression of Tryptophan 2,3-Dioxygenase and Production of Kynurenine Pathway Metabolites in Triple Transgenic Mice and Human Alzheimer’s Disease Brain. Adlard PA, ed. PLoS ONE. 2013;8(4):e59749.
  • TDO2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    TDO2 cDNA ORF Clone in Cloning Vector, Rat RG81645-G
    TDO2 cDNA ORF Clone, Rat, untagged RG81645-UT
    TDO2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81645-ACG
    TDO2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81645-ACGLN
    TDO2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81645-ACR
    TDO2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81645-CF
    TDO2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81645-NF
    TDO2 cDNA ORF Clone, Rat, C-His tag RG81645-CH
    TDO2 cDNA ORF Clone, Rat, N-His tag RG81645-NH
    TDO2 cDNA ORF Clone, Rat, C-HA tag RG81645-CY
    TDO2 cDNA ORF Clone, Rat, N-HA tag RG81645-NY
    TDO2 cDNA ORF Clone, Rat, C-Myc tag RG81645-CM
    TDO2 cDNA ORF Clone, Rat, N-Myc tag RG81645-NM

    TDO2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TDO2 cDNA ORF Clone in Cloning Vector, Mouse MG53246-U
    TDO2 cDNA ORF Clone, Mouse, untagged MG53246-UT
    TDO2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53246-ACG
    TDO2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53246-ACGLN
    TDO2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53246-ANG
    TDO2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53246-ACR
    TDO2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53246-ANR
    TDO2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53246-CF
    TDO2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53246-NF
    TDO2 cDNA ORF Clone, Mouse, C-His tag MG53246-CH
    TDO2 cDNA ORF Clone, Mouse, N-His tag MG53246-NH
    TDO2 cDNA ORF Clone, Mouse, C-HA tag MG53246-CY
    TDO2 cDNA ORF Clone, Mouse, N-HA tag MG53246-NY
    TDO2 cDNA ORF Clone, Mouse, C-Myc tag MG53246-CM
    TDO2 cDNA ORF Clone, Mouse, N-Myc tag MG53246-NM

    TDO2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TDO2 cDNA ORF Clone in Cloning Vector, Human HG13215-G
    TDO2 cDNA ORF Clone, Human, untagged HG13215-UT
    TDO2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13215-ACGLN
    TDO2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13215-ACG
    TDO2 cDNA ORF Clone, Human, N-GFPSpark® tag HG13215-ANG
    TDO2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13215-ACR
    TDO2 cDNA ORF Clone, Human, N-OFPSpark® tag HG13215-ANR
    TDO2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13215-CF
    TDO2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13215-NF
    TDO2 cDNA ORF Clone, Human, C-His tag HG13215-CH
    TDO2 cDNA ORF Clone, Human, C-HA tag HG13215-CY
    TDO2 cDNA ORF Clone, Human, N-HA tag HG13215-NY
    TDO2 cDNA ORF Clone, Human, C-Myc tag HG13215-CM
    TDO2 cDNA ORF Clone, Human, N-Myc tag HG13215-NM
    TDO2 qPCR Primer Pairs, Human HP101786
    info info
    添加购物车成功! 添加购物车失败!