After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Cripto/TDGF1/ CRGF Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human TDGF1 cDNA Clone Product Information
NCBI RefSeq:NM_003212.2
RefSeq ORF Size:567bp
cDNA Description:Full length Clone DNA of Homo sapiens teratocarcinoma-derived growth factor 1 with N terminal His tag.
Gene Synonym:CR, CRGF, CRIPTO, Cripto-1
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Cripto/TDGF1 is a member of the epidermal growth factor (EGF)- Cripto, Frl-1, and Cryptic (CFC) family. EGF-CFC family member proteins share a variant EGF-like motif, a conserved cysteine-rich domain, and a C-terminal hydrophobic region. Before gastrulation, Cripto is asymmetrically expressed in a proximal–distal gradient in the epiblast, and subsequently is expressed in the primitive streak and newly formed embryonic mesoderm. These proteins play key roles in intercellular signaling pathways during vertebrate embryogenesis. Mutations in Cripto/TDGF1 can cause autosomal visceral heterotaxy. Cripto/TDGF1 is involved in left-right asymmetric morphogenesis during organ development. Cripto signalling is essential for the conversion of a proximal–distal asymmetry into an orthogonal anterior–posterior axis. The mechanism of inhibitory effects of the Cripto includes both cancer cell apoptosis, activation of c-Jun-NH(2)-terminal kinase and p38 kinase signaling pathways and blocking of Akt phosphorylation. Thus, Cripto is a unique target, and Immunohistochemistry to Cripto could be of therapeutic value for human cancers.

References
  • Calvanese L, et al. (2006) Solution structure of mouse Cripto CFC domain and its inactive variant Trp107Ala. J Med Chem. 49 (24): 7054-62.
  • Lonardo E, et al. (2010) A small synthetic cripto blocking Peptide improves neural induction, dopaminergic differentiation, and functional integration of mouse embryonic stem cells in a rat model of Parkinson's disease. Stem Cells. 28 (8): 1326-37.
  • Chambery A, et al. (2009) Qualitative and quantitative proteomic profiling of cripto(-/-) embryonic stem cells by means of accurate mass LC-MS analysis. J Proteome Res. 8 (2): 1047-58.
  • Size / Price
    Catalog: HG10908-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"