After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human TCN2 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human TCN2 cDNA Clone Product Information
NCBI RefSeq:NM_000355.2
RefSeq ORF Size:1284bp
cDNA Description:Full length Clone DNA of Homo sapiens transcobalamin II; macrocytic anemia with C terminal HA tag.
Gene Synonym:TC2, D22S676, D22S750
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Transcobalamin II, also known as TCN2 and TC II, is a plasma protein that binds cobalamin (Cbl; vitamin B12) as it is absorbed in the terminal ileum and distributes to tissues. The circulating transcobalamin II-cobalamin complex binds to receptors on the plasma membrane of tissue cells and is then internalized by receptor-mediated endocytosis. Transcobalamin II is a non-glycolated secretory protein of molecular mass 43 kDa. Its plasma membrane receptor (TC II-R) is a heavily glycosylated protein with a monomeric molecular mass of 62 kDa. Human TCN2 gene is composed of nine exons and eight introns spanning approximately 20 kb with multiple potential transcription start sites. A number of genetic abnormalities are characterized either by a failure to express TCN2 or by synthesis of an abnormal protein. The TCN2 deficiency results in cellular cobalamin deficiency, an early onset of megaloblastic anaemia, and neurological abnormalities.

References
  • Rothenberg, S. P. et al., 1995, Baillieres Clin Haematol. 8 (3):499-514.
  • Bibi, H. et al., 1999, J Inherit Metab Dis. 22 (7):765-772.
  • Seetharam,B. et al.,2000, Vitam Horm. 59 :337-366. 
  • Size / Price
    Catalog: HG10566-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"