TCHP cDNA ORF Clone, Human, C-Myc tag

Cat: HG14867-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TCHP Reagents
CRO Services
Product recommended

All TCHP Reagents
TCHP cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1497 bp
Description
Full length Clone DNA of Human trichoplein, keratin filament binding with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TCHP cDNA ORF Clone, Human, C-Myc tag Alternative Names
TpMs cDNA ORF Clone, Human
TCHP Background Information
Full Name
trichoplein, keratin filament binding

TCHP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TCHP cDNA ORF Clone in Cloning Vector, Mouse MG5A5303-U
TCHP cDNA ORF Clone, Mouse, untagged MG5A5303-UT
TCHP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5303-ACGLN
TCHP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5303-ACG
TCHP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A5303-ANG
TCHP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A5303-ACR
TCHP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A5303-ANR
TCHP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A5303-CF
TCHP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A5303-NF
TCHP cDNA ORF Clone, Mouse, C-His tag MG5A5303-CH
TCHP cDNA ORF Clone, Mouse, N-His tag MG5A5303-NH
TCHP cDNA ORF Clone, Mouse, C-HA tag MG5A5303-CY
TCHP cDNA ORF Clone, Mouse, N-HA tag MG5A5303-NY
TCHP cDNA ORF Clone, Mouse, C-Myc tag MG5A5303-CM
TCHP cDNA ORF Clone, Mouse, N-Myc tag MG5A5303-NM

TCHP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TCHP cDNA ORF Clone in Cloning Vector, Human HG14867-G
TCHP cDNA ORF Clone, Human, untagged HG14867-UT
TCHP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14867-ACGLN
TCHP cDNA ORF Clone, Human, C-GFPSpark® tag HG14867-ACG
TCHP cDNA ORF Clone, Human, N-GFPSpark® tag HG14867-ANG
TCHP cDNA ORF Clone, Human, C-OFPSpark® tag HG14867-ACR
TCHP cDNA ORF Clone, Human, N-OFPSpark® tag HG14867-ANR
TCHP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14867-CF
TCHP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14867-NF
TCHP cDNA ORF Clone, Human, C-His tag HG14867-CH
TCHP cDNA ORF Clone, Human, N-His tag HG14867-NH
TCHP cDNA ORF Clone, Human, C-HA tag HG14867-CY
TCHP cDNA ORF Clone, Human, N-HA tag HG14867-NY
TCHP cDNA ORF Clone, Human, N-Myc tag HG14867-NM
TCHP qPCR Primer Pairs, Human HP103498
info info
添加购物车成功! 添加购物车失败!