TBRG4 cDNA ORF Clone, Human, N-His tag

Cat: HG14941-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TBRG4 Reagents
CRO Services
Product recommended

All TBRG4 Reagents
TBRG4 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1896 bp
Description
Full length Clone DNA of Human transforming growth factor beta regulator 4 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TBRG4 cDNA ORF Clone, Human, N-His tag Alternative Names
CPR2 cDNA ORF Clone, Human;FASTKD4 cDNA ORF Clone, Human
TBRG4 Background Information
Full Name
transforming growth factor beta regulator 4

TBRG4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TBRG4 cDNA ORF Clone in Cloning Vector, Mouse MG53220-G
TBRG4 cDNA ORF Clone, Mouse, untagged MG53220-UT
TBRG4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53220-ACG
TBRG4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53220-ACGLN
TBRG4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53220-ANG
TBRG4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53220-ACR
TBRG4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53220-ANR
TBRG4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53220-CF
TBRG4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53220-NF
TBRG4 cDNA ORF Clone, Mouse, C-His tag MG53220-CH
TBRG4 cDNA ORF Clone, Mouse, N-His tag MG53220-NH
TBRG4 cDNA ORF Clone, Mouse, C-HA tag MG53220-CY
TBRG4 cDNA ORF Clone, Mouse, N-HA tag MG53220-NY
TBRG4 cDNA ORF Clone, Mouse, C-Myc tag MG53220-CM
TBRG4 cDNA ORF Clone, Mouse, N-Myc tag MG53220-NM

TBRG4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TBRG4 cDNA ORF Clone in Cloning Vector, Human HG14941-G
TBRG4 cDNA ORF Clone, Human, untagged HG14941-UT
TBRG4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14941-ACGLN
TBRG4 cDNA ORF Clone, Human, C-GFPSpark® tag HG14941-ACG
TBRG4 cDNA ORF Clone, Human, N-GFPSpark® tag HG14941-ANG
TBRG4 cDNA ORF Clone, Human, C-OFPSpark® tag HG14941-ACR
TBRG4 cDNA ORF Clone, Human, N-OFPSpark® tag HG14941-ANR
TBRG4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14941-CF
TBRG4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14941-NF
TBRG4 cDNA ORF Clone, Human, C-His tag HG14941-CH
TBRG4 cDNA ORF Clone, Human, C-HA tag HG14941-CY
TBRG4 cDNA ORF Clone, Human, N-HA tag HG14941-NY
TBRG4 cDNA ORF Clone, Human, C-Myc tag HG14941-CM
TBRG4 cDNA ORF Clone, Human, N-Myc tag HG14941-NM
TBRG4 qPCR Primer Pairs, Human HP103570
info info
添加购物车成功! 添加购物车失败!