TBL2 cDNA ORF Clone, Human, C-Myc tag

Cat: HG13588-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TBL2 Reagents
CRO Services
Product recommended

All TBL2 Reagents
TBL2 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1341 bp
Description
Full length Clone DNA of Human transducin (beta)-like 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TBL2 cDNA ORF Clone, Human, C-Myc tag Alternative Names
WBSCR13 cDNA ORF Clone, Human;WS-betaTRP cDNA ORF Clone, Human
TBL2 Background Information
Full Name
transducin (beta)-like 2

TBL2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TBL2 cDNA ORF Clone in Cloning Vector, Mouse MG53472-G
TBL2 cDNA ORF Clone, Mouse, untagged MG53472-UT
TBL2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53472-ACGLN
TBL2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53472-ACG
TBL2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53472-ANG
TBL2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53472-ACR
TBL2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53472-ANR
TBL2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53472-CF
TBL2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53472-NF
TBL2 cDNA ORF Clone, Mouse, C-His tag MG53472-CH
TBL2 cDNA ORF Clone, Mouse, N-His tag MG53472-NH
TBL2 cDNA ORF Clone, Mouse, C-HA tag MG53472-CY
TBL2 cDNA ORF Clone, Mouse, N-HA tag MG53472-NY
TBL2 cDNA ORF Clone, Mouse, C-Myc tag MG53472-CM
TBL2 cDNA ORF Clone, Mouse, N-Myc tag MG53472-NM

TBL2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TBL2 cDNA ORF Clone in Cloning Vector, Human HG13588-G
TBL2 cDNA ORF Clone, Human, untagged HG13588-UT
TBL2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13588-ACG
TBL2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13588-ACGLN
TBL2 cDNA ORF Clone, Human, N-GFPSpark® tag HG13588-ANG
TBL2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13588-ACR
TBL2 cDNA ORF Clone, Human, N-OFPSpark® tag HG13588-ANR
TBL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13588-CF
TBL2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13588-NF
TBL2 cDNA ORF Clone, Human, C-His tag HG13588-CH
TBL2 cDNA ORF Clone, Human, N-His tag HG13588-NH
TBL2 cDNA ORF Clone, Human, C-HA tag HG13588-CY
TBL2 cDNA ORF Clone, Human, N-HA tag HG13588-NY
TBL2 cDNA ORF Clone, Human, N-Myc tag HG13588-NM
TBL2 qPCR Primer Pairs, Human HP102274
info info
添加购物车成功! 添加购物车失败!