TBK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11023-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TBK1 Reagents
CRO Services
Product recommended

All TBK1 Reagents
TBK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2190 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human TANK-binding kinase 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 2.24kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
TBK1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TBK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
TBK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
NAK cDNA ORF Clone, Human;T2K cDNA ORF Clone, Human
TBK1 Background Information
Full Name
TANK-binding kinase 1

TBK1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TBK1 cDNA ORF Clone in Cloning Vector, Mouse MG58099-U
TBK1 cDNA ORF Clone, Mouse, untagged MG58099-UT
TBK1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58099-ACGLN
TBK1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58099-ACG
TBK1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58099-ANG
TBK1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58099-ACR
TBK1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58099-ANR
TBK1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58099-CF
TBK1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58099-NF
TBK1 cDNA ORF Clone, Mouse, C-His tag MG58099-CH
TBK1 cDNA ORF Clone, Mouse, N-His tag MG58099-NH
TBK1 cDNA ORF Clone, Mouse, C-HA tag MG58099-CY
TBK1 cDNA ORF Clone, Mouse, N-HA tag MG58099-NY
TBK1 cDNA ORF Clone, Mouse, C-Myc tag MG58099-CM
TBK1 cDNA ORF Clone, Mouse, N-Myc tag MG58099-NM

TBK1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TBK1 cDNA ORF Clone in Cloning Vector, Human HG11023-M
TBK1 cDNA ORF Clone, Human, untagged HG11023-UT
TBK1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11023-ACG
TBK1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11023-ACGLN
TBK1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11023-ANG
TBK1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11023-ACR
TBK1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11023-ANR
TBK1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11023-NF
TBK1 cDNA ORF Clone, Human, C-His tag HG11023-CH
TBK1 cDNA ORF Clone, Human, N-His tag HG11023-NH
TBK1 cDNA ORF Clone, Human, C-HA tag HG11023-CY
TBK1 cDNA ORF Clone, Human, N-HA tag HG11023-NY
TBK1 cDNA ORF Clone, Human, C-Myc tag HG11023-CM
TBK1 cDNA ORF Clone, Human, N-Myc tag HG11023-NM
TBK1 qPCR Primer Pairs, Human HP100983
info info
添加购物车成功! 添加购物车失败!