Quick Order

Human TBCB Gene ORF cDNA clone expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human TBCB cDNA Clone Product Information
    NCBI RefSeq:BC005969
    RefSeq ORF Size:735bp
    cDNA Description:Full length Clone DNA of Homo sapiens tubulin folding cofactor B with N terminal His tag.
    Gene Synonym:CG22, CKAP1, CKAPI, MGC14625
    Species:Human
    Vector:pCMV3-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TBCB qPCR primers for gene expression analysis, HP102910 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Background

    Tubulin-folding cofactor B, also known as TBCB, belongs to the TBCB family. It contains 1 CAP-Gly domain and can be detected in most tissues. TBCB binds to alpha-tubulin folding intermediates after their interaction with cytosolic chaperonin in the pathway. The cytoskeleton is composed of 3 structural elements: actin filaments, microtubules, and intermediate filaments. TBCB is involved in regulation of tubulin heterodimer dissociation. It may function as a negative regulator of axonal growth.

    References
  • Feingold EA, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Tian G, et al. (1997) Tubulin subunits exist in an activated conformational state generated and maintained by protein cofactors. J Cell Biol. 138(4):821-32.
  • Wolz W, et al. (1997) A complex satellite DNA polymorphism flanking the human ryanodine receptor gene (RYR1). Cytogenet Cell Genet. 72(2-3):215-6.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"