TARDBP cDNA ORF Clone, Human, N-Myc tag

Cat: HG13201-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TARDBP Reagents
CRO Services
Product recommended

All TARDBP Reagents
TARDBP cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1245 bp
Description
Full length Clone DNA of Human TAR DNA.binding protein with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TARDBP cDNA ORF Clone, Human, N-Myc tag Alternative Names
ALS10 cDNA ORF Clone, Human;TDP-43 cDNA ORF Clone, Human
TARDBP Background Information
Full Name
TAR DNA binding protein

TARDBP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TARDBP cDNA ORF Clone in Cloning Vector, Mouse MG53684-U
TARDBP cDNA ORF Clone, Mouse, untagged MG53684-UT
TARDBP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53684-ACG
TARDBP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53684-ACGLN
TARDBP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53684-ANG
TARDBP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53684-ACR
TARDBP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53684-ANR
TARDBP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53684-CF
TARDBP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53684-NF
TARDBP cDNA ORF Clone, Mouse, C-His tag MG53684-CH
TARDBP cDNA ORF Clone, Mouse, N-His tag MG53684-NH
TARDBP cDNA ORF Clone, Mouse, C-HA tag MG53684-CY
TARDBP cDNA ORF Clone, Mouse, N-HA tag MG53684-NY
TARDBP cDNA ORF Clone, Mouse, C-Myc tag MG53684-CM
TARDBP cDNA ORF Clone, Mouse, N-Myc tag MG53684-NM

TARDBP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TARDBP cDNA ORF Clone in Cloning Vector, Human HG13201-G
TARDBP cDNA ORF Clone, Human, untagged HG13201-UT
TARDBP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13201-ACGLN
TARDBP cDNA ORF Clone, Human, C-GFPSpark® tag HG13201-ACG
TARDBP cDNA ORF Clone, Human, N-GFPSpark® tag HG13201-ANG
TARDBP cDNA ORF Clone, Human, C-OFPSpark® tag HG13201-ACR
TARDBP cDNA ORF Clone, Human, N-OFPSpark® tag HG13201-ANR
TARDBP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13201-CF
TARDBP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13201-NF
TARDBP cDNA ORF Clone, Human, C-His tag HG13201-CH
TARDBP cDNA ORF Clone, Human, N-His tag HG13201-NH
TARDBP cDNA ORF Clone, Human, C-HA tag HG13201-CY
TARDBP cDNA ORF Clone, Human, N-HA tag HG13201-NY
TARDBP cDNA ORF Clone, Human, C-Myc tag HG13201-CM
TARDBP qPCR Primer Pairs, Human HP101726
info info
添加购物车成功! 添加购物车失败!