Quick Order

Text Size:AAA

Human TAOK3/JIK Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human TAOK3 cDNA Clone Product Information
NCBI RefSeq:NM_016281.3
RefSeq ORF Size:2697bp
cDNA Description:Full length Clone DNA of Homo sapiens TAO kinase 3 with N terminal Myc tag.
Gene Synonym:DPK, JIK, MAP3K18, FLJ31808, DKFZp666H245, TAOK3
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Serine/threonine-protein kinase TAO3, also known as cutaneous T-cell lymphoma-associated antigen HD-CL-09, CTCL-associated antigen HD-CL-09, Dendritic cell-derived protein kinase, JNK / SAPK-inhibitory kinase, Jun kinase-inhibitory kinase, Kinase from chicken homolog A, Thousand and one amino acid protein 3, JIK, TAOK3 and MAP3K18, is cytoplasm and peripheral membrane protein which belongs to the protein kinase superfamily, STE Ser/Thr protein kinase family and STE20 subfamily. Protein kinases are pivotal regulators of cell signaling that modulate each other's functions and activities through site-specific phosphorylation events. TAOK3 / JIK contains one protein kinase domain. TAOK3 / JIK is ubiquitously expressed at a low level, and highly expressed in peripheral blood leukocytes (PBLs), thymus, spleen, kidney, skeletal muscle, heart and liver. TAOK3 / JIK inhibits the basal activity of Jun kinase. It is negatively regulated by epidermal growth factor (EGF). When overexpressed, TAOK3 / JIK may activate ERK1 / ERK2 and JNK / SAPK.

References
  • Tassi E., et al., 1999, J. Biol. Chem. 274:33287-95.
  • Yoneda T., et al., 2001, J. Biol. Chem. 276:13935-40.
  • Yustein J.T., et al.,2003, Oncogene 22:6129-41.
  • Daub H., et al., 2008, Mol. Cell 31:438-48.
  • Size / Price
    Catalog: HG11547-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"