Transgelin cDNA ORF Clone, Human, N-His tag

Cat: HG14991-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Transgelin Reagents
CRO Services
Product recommended

All Transgelin Reagents
Transgelin cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
606 bp
Description
Full length Clone DNA of Human transgelin with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Transgelin cDNA ORF Clone, Human, N-His tag Alternative Names
SM22 cDNA ORF Clone, Human;SMCC cDNA ORF Clone, Human;TAGLN1 cDNA ORF Clone, Human;WS3-10 cDNA ORF Clone, Human
Transgelin Background Information
Full Name
transgelin

Transgelin cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Transgelin cDNA ORF Clone in Cloning Vector, Rat RG80546-U
Transgelin cDNA ORF Clone, Rat, untagged RG80546-UT
Transgelin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80546-ACGLN
Transgelin cDNA ORF Clone, Rat, C-GFPSpark® tag RG80546-ACG
Transgelin cDNA ORF Clone, Rat, N-GFPSpark® tag RG80546-ANG
Transgelin cDNA ORF Clone, Rat, C-OFPSpark® tag RG80546-ACR
Transgelin cDNA ORF Clone, Rat, N-OFPSpark® tag RG80546-ANR
Transgelin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80546-CF
Transgelin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80546-NF
Transgelin cDNA ORF Clone, Rat, C-His tag RG80546-CH
Transgelin cDNA ORF Clone, Rat, N-His tag RG80546-NH
Transgelin cDNA ORF Clone, Rat, C-HA tag RG80546-CY
Transgelin cDNA ORF Clone, Rat, N-HA tag RG80546-NY
Transgelin cDNA ORF Clone, Rat, C-Myc tag RG80546-CM
Transgelin cDNA ORF Clone, Rat, N-Myc tag RG80546-NM
Transgelin qPCR Primer Pairs, Rat RP300510

Transgelin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Transgelin cDNA ORF Clone in Cloning Vector, Human HG14991-G
Transgelin cDNA ORF Clone, Human, untagged HG14991-UT
Transgelin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14991-ACGLN
Transgelin cDNA ORF Clone, Human, C-GFPSpark® tag HG14991-ACG
Transgelin cDNA ORF Clone, Human, N-GFPSpark® tag HG14991-ANG
Transgelin cDNA ORF Clone, Human, C-OFPSpark® tag HG14991-ACR
Transgelin cDNA ORF Clone, Human, N-OFPSpark® tag HG14991-ANR
Transgelin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14991-CF
Transgelin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14991-NF
Transgelin cDNA ORF Clone, Human, C-His tag HG14991-CH
Transgelin cDNA ORF Clone, Human, C-HA tag HG14991-CY
Transgelin cDNA ORF Clone, Human, N-HA tag HG14991-NY
Transgelin cDNA ORF Clone, Human, C-Myc tag HG14991-CM
Transgelin cDNA ORF Clone, Human, N-Myc tag HG14991-NM
Transgelin qPCR Primer Pairs, Human HP103619
info info
添加购物车成功! 添加购物车失败!