TAF9 cDNA ORF Clone, Human, C-Myc tag

Cat: HG16493-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TAF9 Reagents
CRO Services
Product recommended

All TAF9 Reagents
TAF9 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
795 bp
Description
Full length Clone DNA of Human TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TAF9 cDNA ORF Clone, Human, C-Myc tag Alternative Names
MGC:5067 cDNA ORF Clone, Human;STAF31/32 cDNA ORF Clone, Human;TAF2G cDNA ORF Clone, Human;TAFII-31 cDNA ORF Clone, Human;TAFII-32 cDNA ORF Clone, Human;TAFII31 cDNA ORF Clone, Human;TAFII32 cDNA ORF Clone, Human;TAFIID32 cDNA ORF Clone, Human
TAF9 Background Information
Full Name
TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa

TAF9 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TAF9 cDNA ORF Clone in Cloning Vector, Rat RG80698-U
TAF9 cDNA ORF Clone, Rat, untagged RG80698-UT
TAF9 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80698-ACGLN
TAF9 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80698-ACG
TAF9 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80698-ANG
TAF9 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80698-ACR
TAF9 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80698-ANR
TAF9 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80698-CF
TAF9 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80698-NF
TAF9 cDNA ORF Clone, Rat, C-His tag RG80698-CH
TAF9 cDNA ORF Clone, Rat, N-His tag RG80698-NH
TAF9 cDNA ORF Clone, Rat, C-HA tag RG80698-CY
TAF9 cDNA ORF Clone, Rat, N-HA tag RG80698-NY
TAF9 cDNA ORF Clone, Rat, C-Myc tag RG80698-CM
TAF9 cDNA ORF Clone, Rat, N-Myc tag RG80698-NM
TAF9 qPCR Primer Pairs, Rat RP300662

TAF9 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TAF9 cDNA ORF Clone in Cloning Vector, Human HG16493-G
TAF9 cDNA ORF Clone, Human, untagged HG16493-UT
TAF9 cDNA ORF Clone, Human, C-GFPSpark® tag HG16493-ACG
TAF9 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16493-ACGLN
TAF9 cDNA ORF Clone, Human, N-GFPSpark® tag HG16493-ANG
TAF9 cDNA ORF Clone, Human, C-OFPSpark® tag HG16493-ACR
TAF9 cDNA ORF Clone, Human, N-OFPSpark® tag HG16493-ANR
TAF9 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16493-CF
TAF9 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16493-NF
TAF9 cDNA ORF Clone, Human, C-His tag HG16493-CH
TAF9 cDNA ORF Clone, Human, N-His tag HG16493-NH
TAF9 cDNA ORF Clone, Human, C-HA tag HG16493-CY
TAF9 cDNA ORF Clone, Human, N-HA tag HG16493-NY
TAF9 cDNA ORF Clone, Human, N-Myc tag HG16493-NM
info info
添加购物车成功! 添加购物车失败!