Syndecan-4 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG10653-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Syndecan-4 Reagents
CRO Services
Product recommended

All Syndecan-4 Reagents
Syndecan-4 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
597 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human syndecan 4 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Restriction Sites
KpnI + NotI (6kb + 0.63kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Syndecan-4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Syndecan-4 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Human IL12A / IL-12A Gene Plasmid Map 5645
Syndecan-4 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
SYND4 cDNA ORF Clone, Human
Syndecan-4 Background Information

SDC4 (Syndecan-4), also known as Syn4, is a transmembrane heparan sulfate proteoglycan that co-operates with integrins during cell-matrix interactions for the assembly of focal adhesions and actin stress fibers and in the phosphorylation of focal adhesion kinase (FAK) on Tyr397. Syndecan-4 plays roles in the formation of focal adhesions and stress fibers. The cytoplasmic domain of syndecan-4 interacts with a number of signalling and structural proteins, and both extracellular and cytoplasmic domains are necessary for regulated activation of associated transmembrane receptors. Syndecan-4/SDC4 is a heparan sulfate proteoglycan and works as a coreceptor for various growth factors. SDC4 deficiency limits neointimal formation after vascular injury by regulating vascular smooth muscle cells (VSMCs) proliferation and vascular progenitor cells (VPCs) mobilization. Therefore, SDC4 may be a novel therapeutic target for preventing arterial restenosis after angioplasty.

Full Name
syndecan 4
References
  • Ikesue M, et al. (2011) Syndecan-4 deficiency limits neointimal formation after vascular injury by regulating vascular smooth muscle cell proliferation and vascular progenitor cell mobilization. Arterioscler Thromb Vasc Biol. 31(5): 1066-74.
  • Saoncella S, et al. (2004) Syndecan-4 regulates ATF-2 transcriptional activity in a Rac1-dependent manner. J Biol Chem. 279(45): 47172-6.
  • Bass MD, et al. (2002) Cytoplasmic interactions of syndecan-4 orchestrate adhesion receptor and growth factor receptor signalling. Biochem J. 368(Pt 1): 1-15.
  • Couchman JR, et al. (1999) Syndecan-4 and integrins: combinatorial signaling in cell adhesion. J Cell Sci. 112 ( Pt 20): 3415-20.
  • Syndecan-4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Syndecan-4 cDNA ORF Clone in Cloning Vector, Mouse MG50726-G
    Syndecan-4 cDNA ORF Clone, Mouse, untagged MG50726-UT
    Syndecan-4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50726-ACG
    Syndecan-4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50726-ACGLN
    Syndecan-4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50726-ACR
    Syndecan-4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50726-CF
    Syndecan-4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50726-NF
    Syndecan-4 cDNA ORF Clone, Mouse, C-His tag MG50726-CH
    Syndecan-4 cDNA ORF Clone, Mouse, N-His tag MG50726-NH
    Syndecan-4 cDNA ORF Clone, Mouse, C-HA tag MG50726-CY
    Syndecan-4 cDNA ORF Clone, Mouse, N-HA tag MG50726-NY
    Syndecan-4 cDNA ORF Clone, Mouse, C-Myc tag MG50726-CM
    Syndecan-4 cDNA ORF Clone, Mouse, N-Myc tag MG50726-NM
    Syndecan-4 qPCR Primer Pairs, Mouse MP200701

    Syndecan-4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Syndecan-4 cDNA ORF Clone in Cloning Vector, Human HG10653-M
    Syndecan-4 cDNA ORF Clone, Human, untagged HG10653-UT
    Syndecan-4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10653-ACG
    Syndecan-4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10653-ACGLN
    Syndecan-4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10653-ACR
    Syndecan-4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10653-CF
    Syndecan-4 cDNA ORF Clone, Human, C-His tag HG10653-CH
    Syndecan-4 cDNA ORF Clone, Human, N-His tag HG10653-NH
    Syndecan-4 cDNA ORF Clone, Human, C-HA tag HG10653-CY
    Syndecan-4 cDNA ORF Clone, Human, N-HA tag HG10653-NY
    Syndecan-4 cDNA ORF Clone, Human, C-Myc tag HG10653-CM
    Syndecan-4 cDNA ORF Clone, Human, N-Myc tag HG10653-NM
    Syndecan-4 qPCR Primer Pairs, Human HP100625
    info info
    添加购物车成功! 添加购物车失败!