DKKL1 cDNA ORF Clone, Human, N-His tag

Cat: HG10840-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DKKL1 Reagents
CRO Services
Product recommended

All DKKL1 Reagents
DKKL1 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
729 bp
Description
Full length Clone DNA of Human dickkopf-like 1 (soggy) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DKKL1 cDNA ORF Clone, Human, N-His tag Alternative Names
CT34 cDNA ORF Clone, Human;SGY cDNA ORF Clone, Human;SGY-1 cDNA ORF Clone, Human;SGY1 cDNA ORF Clone, Human
DKKL1 Background Information

Dickkopf-like 1 (DKKL1) or soggy 1, is a glycoprotein unique to mammals that is expressed primarily in developing spermatocytes and localized in the acrosome of mature sperm. It is also expressed in the trophectoderm / placental lineage. This glycoprotein is secreted by postmeiotic male germ cells. DKKL1 is a member of the Dickkopf (DKK) family, a group of proteins that are characterized as secreted antagonists of Wnt signal transduction proteins. In mammals, embryos lacking DKKL1 protein developed into viable, fertile adults. DKKL1, either directly or indirectly, facilitates the ability of sperm to penetrate the zona pellucid. DKKL1 is related to the sperm apoptotic procession. Molecular analyses identified the Fas death ligand (FasL) as a target for DkkL1 pro-apoptotic activity in adult mice. DKKL1 is considered as a negative regulator of adult testic homeostasis and identifies a novel, DKKL1 / FasL- dependent, regulation that specifically controls the number of postpubertal spermatocytes. 

Full Name
dickkopf-like 1
References
  • Niehrs C. (2006) Function and biological roles of the Dickkopf family of Wnt modulators. Oncogene. 25 (57): 7469-81.
  • Kohn MJ, et al. (2010) The Acrosomal Protein Dickkopf-Like 1 (DKKL1) Facilitates Sperm Penetration Of The Zona Pellucida. Fertil Steril. 93 (5): 1533-7.
  • KOHN MJ, et al. (2005) DKKL1 (Soggy), A Dickkopf Family Member, Localizes to the Acrosome During Mammalian Spermatogenesis. Mol Reprod Dev. 71 (4): 516-22.
  • DKKL1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    DKKL1 cDNA ORF Clone in Cloning Vector, Rat RG81585-G

    DKKL1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    DKKL1 cDNA ORF Clone, Mouse, untagged MG5A0125-UT
    DKKL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0125-ACGLN
    DKKL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0125-ACG
    DKKL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0125-ACR
    DKKL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0125-CF
    DKKL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0125-NF
    DKKL1 cDNA ORF Clone, Mouse, C-His tag MG5A0125-CH
    DKKL1 cDNA ORF Clone, Mouse, N-His tag MG5A0125-NH
    DKKL1 cDNA ORF Clone, Mouse, C-HA tag MG5A0125-CY
    DKKL1 cDNA ORF Clone, Mouse, N-HA tag MG5A0125-NY
    DKKL1 cDNA ORF Clone, Mouse, C-Myc tag MG5A0125-CM
    DKKL1 cDNA ORF Clone, Mouse, N-Myc tag MG5A0125-NM

    DKKL1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    DKKL1 cDNA ORF Clone in Cloning Vector, Human HG10840-M
    DKKL1 cDNA ORF Clone, Human, untagged HG10840-UT
    DKKL1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10840-ACG
    DKKL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10840-ACGLN
    DKKL1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10840-ACR
    DKKL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10840-CF
    DKKL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10840-NF
    DKKL1 cDNA ORF Clone, Human, C-His tag HG10840-CH
    DKKL1 cDNA ORF Clone, Human, C-HA tag HG10840-CY
    DKKL1 cDNA ORF Clone, Human, N-HA tag HG10840-NY
    DKKL1 cDNA ORF Clone, Human, C-Myc tag HG10840-CM
    DKKL1 cDNA ORF Clone, Human, N-Myc tag HG10840-NM
    DKKL1 qPCR Primer Pairs, Human HP100739
    info info
    添加购物车成功! 添加购物车失败!