Smad3 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10892-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Smad3 Reagents
CRO Services
Product recommended

All Smad3 Reagents
Smad3 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1278 bp
Description
Full length Clone DNA of Human SMAD family member 3 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Smad3 cDNA ORF Clone, Human, N-Myc tag Alternative Names
HSPC193 cDNA ORF Clone, Human;HsT17436 cDNA ORF Clone, Human;JV15-2 cDNA ORF Clone, Human;LDS1C cDNA ORF Clone, Human;LDS3 cDNA ORF Clone, Human;MADH3 cDNA ORF Clone, Human
Smad3 Background Information

SMAD3 belongs to the SMAD family. Members of this family mediate signal transduction by the TGF-beta/activin/BMP-2/4 cytokine superfamily from receptor Ser/Thr protein kinases at the cell surface to the nucleus. SMAD3 is involved in cell signalling. It modulates signals of activin and TGFβ's. Binding of SMAD3 with SMAD4 enables its transmigration into the nucleus where it forms complexes with other proteins and acts as a transcription factor. SMAD3 is a receptor-regulated SMAD (R-SMAD). In mice, mutation of SMAD3 has been linked to colorectal adenocarcinoma, increased systemic inflammation, and accelerated wound healing. Increased SMAD3 activity has been implicated in the pathogenesis of scleroderma. Smad3 is also a multifaceted regulator in adipose physiology and the pathogenesis of obesity and type 2 diabetes.

Full Name
SMAD family member 3
References
  • Tan. et al., 2011, Diabetes. 60 (2): 464-76.
  • Yang X. et al., 1999, Nat Cell Biol. 1 (5): 260-6.
  • Zhu Y. et al., 1998, Cell. 94 (6): 703-14.
  • Feng X. et al., 1996, Nature. 383 (6596): 168-72.
  • Smad3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Smad3 cDNA ORF Clone in Cloning Vector, Mouse MG50991-G
    Smad3 cDNA ORF Clone, Mouse, untagged MG50991-UT
    Smad3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50991-ACGLN
    Smad3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50991-ACG
    Smad3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50991-ANG
    Smad3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50991-ACR
    Smad3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50991-ANR
    Smad3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50991-CF
    Smad3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50991-NF
    Smad3 cDNA ORF Clone, Mouse, C-His tag MG50991-CH
    Smad3 cDNA ORF Clone, Mouse, N-His tag MG50991-NH
    Smad3 cDNA ORF Clone, Mouse, C-HA tag MG50991-CY
    Smad3 cDNA ORF Clone, Mouse, N-HA tag MG50991-NY
    Smad3 cDNA ORF Clone, Mouse, C-Myc tag MG50991-CM
    Smad3 cDNA ORF Clone, Mouse, N-Myc tag MG50991-NM
    Smad3 qPCR Primer Pairs, Mouse MP200957

    Smad3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Smad3 cDNA ORF Clone in Cloning Vector, Human HG10892-M
    Smad3 cDNA ORF Clone, Human, untagged HG10892-UT
    Smad3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10892-ACG
    Smad3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10892-ACGLN
    Smad3 cDNA ORF Clone, Human, N-GFPSpark® tag HG10892-ANG
    Smad3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10892-ACR
    Smad3 cDNA ORF Clone, Human, N-OFPSpark® tag HG10892-ANR
    Smad3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10892-CF
    Smad3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10892-NF
    Smad3 cDNA ORF Clone, Human, C-His tag HG10892-CH
    Smad3 cDNA ORF Clone, Human, N-His tag HG10892-NH
    Smad3 cDNA ORF Clone, Human, C-HA tag HG10892-CY
    Smad3 cDNA ORF Clone, Human, N-HA tag HG10892-NY
    Smad3 cDNA ORF Clone, Human, C-Myc tag HG10892-CM
    Smad3 qPCR Primer Pairs, Human HP100777
    info info
    添加购物车成功! 添加购物车失败!