After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Smad3 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human SMAD3 cDNA Clone Product Information
NCBI RefSeq:NM_005902.3
RefSeq ORF Size:1278bp
cDNA Description:Full length Clone DNA of Homo sapiens SMAD family member 3 with N terminal His tag.
Gene Synonym:MADH3, JV15-2, HSPC193
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

SMAD3 belongs to the SMAD family. Members of this family mediate signal transduction by the TGF-beta/activin/BMP-2/4 cytokine superfamily from receptor Ser/Thr protein kinases at the cell surface to the nucleus. SMAD3 is involved in cell signalling. It modulates signals of activin and TGFβ's. Binding of SMAD3 with SMAD4 enables its transmigration into the nucleus where it forms complexes with other proteins and acts as a transcription factor. SMAD3 is a receptor-regulated SMAD (R-SMAD). In mice, mutation of SMAD3 has been linked to colorectal adenocarcinoma, increased systemic inflammation, and accelerated wound healing. Increased SMAD3 activity has been implicated in the pathogenesis of scleroderma. Smad3 is also a multifaceted regulator in adipose physiology and the pathogenesis of obesity and type 2 diabetes.

References
  • Tan. et al., 2011, Diabetes. 60 (2): 464-76.
  • Yang X. et al., 1999, Nat Cell Biol. 1 (5): 260-6.
  • Zhu Y. et al., 1998, Cell. 94 (6): 703-14.
  • Feng X. et al., 1996, Nature. 383 (6596): 168-72.
  • Size / Price
    Catalog: HG10892-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"