SerpinB2 cDNA ORF Clone, Human, C-HA tag

Cat: HG10641-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SerpinB2 Reagents
CRO Services
Product recommended

All SerpinB2 Reagents
SerpinB2 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1248 bp
Description
Full length Clone DNA of Human serpin peptidase inhibitor, clade B (ovalbumin), member 2 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SerpinB2 cDNA ORF Clone, Human, C-HA tag Alternative Names
HsT1201 cDNA ORF Clone, Human;PAI cDNA ORF Clone, Human;PAI-2 cDNA ORF Clone, Human;PAI2 cDNA ORF Clone, Human;PLANH2 cDNA ORF Clone, Human
SerpinB2 Background Information

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner.
SerpinB2, also known as Plasminogen activator inhibitor 2, Placental plasminogen activator inhibitor, Monocyte Arg-serpin, Urokinase inhibitor and PAI2, is a cytoplasm protein which belongs to the serpin family and Ov-serpin subfamily. SerpinB2 is a major product of activated monocytes and macrophages and is substantially induced during most inflammatory processes. Distinct from its widely described extracellular role as an inhibitor of urokinase plasminogen activator. SerpinB2 has been shown to have an intracellular role as a retinoblastoma protein (Rb)-binding protein that inhibits Rb degradation. SerpinB2 is widely described as an inhibitor of urokinase plasminogen activator. SerpinB2 inhibits urokinase-type plasminogen activator. The monocyte derived SerpinB2 is distinct from the endothelial cell-derived PAI-1. SerpinB2 is a potentially important inducible host factor that significantly promotes HIV-1 replication.

Full Name
serpin peptidase inhibitor, clade B (ovalbumin), member 2
References
  • Sumi, Y. et al., 1989, J. Biochem. 106: 703-7.
  • Rawlings, N.D. et al., 2004, Biochem J. 378: 705-16.
  • Gillard, A. et al., 2006, Am J Nephrol. 26 (1): 34-42.
  • Schroder,WA. et al., 2010, J Immunol. 184 (5): 2663-70.
  • SerpinB2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SerpinB2 cDNA ORF Clone, Mouse, untagged MG58945-UT
    SerpinB2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58945-ACGLN
    SerpinB2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58945-ACG
    SerpinB2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58945-ANG
    SerpinB2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58945-ACR
    SerpinB2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58945-ANR
    SerpinB2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58945-CF
    SerpinB2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58945-NF
    SerpinB2 cDNA ORF Clone, Mouse, C-His tag MG58945-CH
    SerpinB2 cDNA ORF Clone, Mouse, N-His tag MG58945-NH
    SerpinB2 cDNA ORF Clone, Mouse, C-HA tag MG58945-CY
    SerpinB2 cDNA ORF Clone, Mouse, N-HA tag MG58945-NY
    SerpinB2 cDNA ORF Clone, Mouse, C-Myc tag MG58945-CM
    SerpinB2 cDNA ORF Clone, Mouse, N-Myc tag MG58945-NM

    SerpinB2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SerpinB2 cDNA ORF Clone in Cloning Vector, Human HG10641-M
    SerpinB2 cDNA ORF Clone, Human, untagged HG10641-UT
    SerpinB2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10641-ACGLN
    SerpinB2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10641-ACG
    SerpinB2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10641-ANG
    SerpinB2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10641-ACR
    SerpinB2 cDNA ORF Clone, Human, N-OFPSpark® tag HG10641-ANR
    SerpinB2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10641-CF
    SerpinB2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10641-NF
    SerpinB2 cDNA ORF Clone, Human, C-His tag HG10641-CH
    SerpinB2 cDNA ORF Clone, Human, N-His tag HG10641-NH
    SerpinB2 cDNA ORF Clone, Human, N-HA tag HG10641-NY
    SerpinB2 cDNA ORF Clone, Human, C-Myc tag HG10641-CM
    SerpinB2 cDNA ORF Clone, Human, N-Myc tag HG10641-NM
    SerpinB2 qPCR Primer Pairs, Human HP100614
    info info
    添加购物车成功! 添加购物车失败!