PCI cDNA ORF Clone, Human, N-Myc tag

Cat: HG10309-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PCI Reagents
CRO Services
Product recommended

All PCI Reagents
PCI cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1221 bp
Description
Full length Clone DNA of Human serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PCI cDNA ORF Clone, Human, N-Myc tag Alternative Names
PAI-3 cDNA ORF Clone, Human;PAI3 cDNA ORF Clone, Human;PCI cDNA ORF Clone, Human;PCI-B cDNA ORF Clone, Human;PLANH3 cDNA ORF Clone, Human;PROCI cDNA ORF Clone, Human
PCI Background Information

Serpin A5, also well known as protein C inhibitor (PCI), is a member of the human serpin superfamily consists of at least 35 members. It is synthesized in the liver and has been detected in saliva, cerebral spinal fluid, amniotic fluid, tears and semen. As a potent inhibitor of the protein C anticoagulant pathway at the levels of both zymogen activation and enzyme inhibition, serpinA5 additionally inhibits a variety of serine protease including thrombin, factor Xa, several kallekreins and acrosin, and plays a role in the processes of blood coagulation and fertilization. Serpin A5 also inhibits urinary plasminogen activator (uPA), a mediator of tumor cell invasion, and regulates tumor growth and metastasis by inhibiting angiogenesis. Furthermore, recent studies have identified PCI as a potent and direct inhibitor of activated HGFA (hepatocyte growth factor activator), suggesting a novel function in the regulation of tissue repair and regeneration. Similar to serpins C1 and D1, the thrombin inhibitory activity of serpinA5 is enhanced by heparin.

Full Name
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5
Research Areas
References
  • Alireza, R. et al., 1995, J. Biol. Chem. 270: 25336-25339.
  • Silverman, G.A. et al., 2001, J. Biol. Chem. 276: 33293-33296.
  • Malleier, J.M. et al., 2007, Blood. 109: 4769-4776.
  • Asanuma, K. et al., 2007, Int. J. Cancer. 121: 955-965.
  • Hayashi, T. et al., 2007, J. Thromb. Haemost. 5: 1477-1485.
  • info info
    添加购物车成功! 添加购物车失败!