Quick Order

Text Size:AAA

Human SUSD4 / Sushi domain-containing protein 4 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human SUSD4 cDNA Clone Product Information
NCBI RefSeq:BC004888
RefSeq ORF Size:873bp
cDNA Description:Full length Clone DNA of Homo sapiens sushi domain containing 4 with C terminal His tag.
Gene Synonym:PRO222, RP11-239E10.4, SUSD4
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with SUSD4 qPCR primers for gene expression analysis, HP102188 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

SUSD4, also known as sushi domain-containing protein 4, is a hypothetical cell surface protein whose tissue distribution and function are completely unknown. SUSD4 is detectable in murine brains, eyes, spinal cords, and testis but not other tissues. In brains, SUSD4 is highly expressed in the white matter on oligodendrocytes/axons, and in eyes, it is exclusively expressed on the photoreceptor outer segments. In in vitro complement assays, SUSD4 augments the alternative but not the classical pathway of complement activation at the C3 convertase step. SUSD4 deficiency may cause autism or Fryns syndrome, both of which are genetic diseases with severe abnormal neurological development and/or functions.

References
  • Kimura K. et al., 2006, Genome Res. 16 (1): 55-65.
  • Davila S. et al., 2010, Genes Immun. 11 (3): 232-8.
  • Tu Z. et al., 2010, Am J Pathol. 176 (5): 2378-84.
  • Size / Price
    Catalog: HG13488-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"