SULT2B1 cDNA ORF Clone, Human, N-His tag

Cat: HG11410-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SULT2B1 Reagents
CRO Services
Product recommended

All SULT2B1 Reagents
SULT2B1 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1098 bp
Description
Full length Clone DNA of Human sulfotransferase family, cytosolic, 2B, member 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SULT2B1 cDNA ORF Clone, Human, N-His tag Alternative Names
HSST2 cDNA ORF Clone, Human;SULT2B1 cDNA ORF Clone, Human
SULT2B1 Background Information

Sulfotransferase family cytosolic 2B member 1, also known as Sulfotransferase 2B1, ST2B1, Alcohol sulfotransferase, Hydroxysteroid sulfotransferase 2, SULT2B1 and HSST2, is a cytoplasm protein which belongs to the sulfotransferase 1 family. The human hydroxysteroid sulfotransferase (SULT) family is comprised of two subfamilies, SULT2A1 and SULT2B1. SULT2B1 is expressed highly in placenta, prostate and trachea. A lesser expression of SULT1B1 was observed in the small intestine and lung. SULT2B1 catalyzes the sulfate conjugation of many hormones, neurotransmitters, drugs and xenobiotic compounds. Sulfonation increases the water solubility of most compounds, and therefore their renal excretion, but it can also result in bioactivation to form active metabolites. SULT2B1 sulfates hydroxysteroids like DHEA. Isoform 1 preferentially sulfonates cholesterol. The two SULT2B1 isoforms, SULT2B1a and SULT2B1b, are encoded by a single gene as a result of alternative transcription initiation and alternative splicing. SULT2B1b catalyzes the sulfonation of 3beta-hydroxysteroid hormones and cholesterol, whereas SULT2B1a preferentially catalyzes pregnenolone sulfonation.

Full Name
sulfotransferase family 2B member 1
References
  • Fujita K. et al., 1997, J. Biochem. 122:1052-61.
  • Geese,WJ. et al., 2001,Biochem Biophys Res Commun.288 (1): 280-9.
  • Shimizu,C. et al., 2003, Endocrinology. 144 (4):1186-93.
  • Ji,Y. et al., 2007, J Pharmacol Exp Ther. 322 (2): 529-40.
  • info info
    添加购物车成功! 添加购物车失败!