SULT1E1 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG11275-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SULT1E1 Reagents
CRO Services
Product recommended

All SULT1E1 Reagents
SULT1E1 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
885 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 45T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human sulfotransferase family 1E, estrogen-preferring, member 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Restriction Sites
KpnI + XbaI (6kb + 0.92kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
SULT1E1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SULT1E1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Human aFGF/FGF1 Gene Plasmid Map 5637
Human SULT1E1 Gene Expression validated Image 16450
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
SULT1E1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
EST cDNA ORF Clone, Human;EST-1 cDNA ORF Clone, Human;MGC34459 cDNA ORF Clone, Human;ST1E1 cDNA ORF Clone, Human;STE cDNA ORF Clone, Human
SULT1E1 Background Information

Estrogen sulfotransferase, also known as Sulfotransferase, estrogen-preferring, Sulfotransferase 1E1, SULT1E1 and ST1E1, is a cytoplasm enzyme which belongs to the sulfotransferase 1 family. Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. SULT1E1 may control the level of the estrogen receptor by sulfurylating free estradiol. SULT1E1 maximally sulfates beta-estradiol and estrone at concentrations of 20 nM. SULT1E1 also sulfates dehydroepiandrosterone, pregnenolone, ethinylestradiol, equalenin, diethylstilbesterol and 1-naphthol, at significantly higher concentrations; however, cortisol, testosterone and dopamine are not sulfated. SULT1E1 is a key enzyme in estrogen homeostasis. It plays a central role in the prevention and development of human disease.

Full Name
sulfotransferase family 1E member 1
References
  • Bernier F, et al.,1994, J Biol Chem. 269 (45): 28200-5.
  • Strausberg RL, et al.,2003, Proc. Natl. Acad. Sci. 99 (26): 16899-903.
  • Cole,GB. et al., 2010, Proc Natl Acad Sci USA. 107 (14): 6222-7.
  • SULT1E1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SULT1E1 cDNA ORF Clone, Mouse, untagged MG58728-UT
    SULT1E1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58728-ACGLN
    SULT1E1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58728-ACG
    SULT1E1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58728-ANG
    SULT1E1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58728-ACR
    SULT1E1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58728-ANR
    SULT1E1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58728-CF
    SULT1E1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58728-NF
    SULT1E1 cDNA ORF Clone, Mouse, C-His tag MG58728-CH
    SULT1E1 cDNA ORF Clone, Mouse, N-His tag MG58728-NH
    SULT1E1 cDNA ORF Clone, Mouse, C-HA tag MG58728-CY
    SULT1E1 cDNA ORF Clone, Mouse, N-HA tag MG58728-NY
    SULT1E1 cDNA ORF Clone, Mouse, C-Myc tag MG58728-CM
    SULT1E1 cDNA ORF Clone, Mouse, N-Myc tag MG58728-NM

    SULT1E1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SULT1E1 cDNA ORF Clone in Cloning Vector, Human HG11275-M
    SULT1E1 cDNA ORF Clone, Human, untagged HG11275-UT
    SULT1E1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11275-ACGLN
    SULT1E1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11275-ACG
    SULT1E1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11275-ANG
    SULT1E1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11275-ACR
    SULT1E1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11275-ANR
    SULT1E1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11275-CF
    SULT1E1 cDNA ORF Clone, Human, C-His tag HG11275-CH
    SULT1E1 cDNA ORF Clone, Human, N-His tag HG11275-NH
    SULT1E1 cDNA ORF Clone, Human, C-HA tag HG11275-CY
    SULT1E1 cDNA ORF Clone, Human, N-HA tag HG11275-NY
    SULT1E1 cDNA ORF Clone, Human, C-Myc tag HG11275-CM
    SULT1E1 cDNA ORF Clone, Human, N-Myc tag HG11275-NM
    SULT1E1 qPCR Primer Pairs, Human HP101156
    info info
    添加购物车成功! 添加购物车失败!