SULT1B1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG11592-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SULT1B1 Reagents
CRO Services
Product recommended

All SULT1B1 Reagents
SULT1B1 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
891 bp
Description
Full length Clone DNA of Human sulfotransferase family, cytosolic, 1B, member 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SULT1B1 cDNA ORF Clone, Human, N-Myc tag Alternative Names
ST1B1 cDNA ORF Clone, Human;ST1B2 cDNA ORF Clone, Human;SULT1B2 cDNA ORF Clone, Human
SULT1B1 Background Information

Sulfotransferase family cytosolic 1B member 1, also known as Sulfotransferase 1B1, Sulfotransferase 1B2, Thyroid hormone sulfotransferase, SULT1B1 and ST1B2, is a cytoplasm protein which belongs to the sulfotransferase 1 family. Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. SULT1B1 is highly expressed in the liver, peripheral blood leukocytes, colon (mucosal lining), small intestine (jejunum) and spleen. A lesser expression of SULT1B1 was observed in the lung, placenta and thymus. SULT1B1 catalyzes the sulfate conjugation of many hormones, neurotransmitters, drugs and xenobiotic compounds. Sulfonation increases the water solubility of most compounds, and therefore their renal excretion, but it can also result in bioactivation to form active metabolites. SULT1B1 sulfates dopamine, small phenols such as 1-naphthol and p-nitrophenol and thyroid hormones, including 3,3'-diiodothyronine, triidothyronine, reverse triiodothyronine and thyroxine.

Full Name
sulfotransferase family, cytosolic, 1B, member 1
References
  • Fujita K. et al., 1997, J. Biochem. 122:1052-61.
  • Kester,MH.et al., 2003,Am J Physiol Endocrinol Metab. 285 (3):E592-8.
  • Meinl W, et al., 2001, Biochem Biophys Res Commun. 288 (4): 855-62.
  • Dombrovski L. et al., 2006, Proteins 64: 1091-4.
  • SULT1B1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SULT1B1 cDNA ORF Clone, Mouse, untagged MG5A1435-UT
    SULT1B1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1435-ACG
    SULT1B1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1435-ACGLN
    SULT1B1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A1435-ANG
    SULT1B1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1435-ACR
    SULT1B1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A1435-ANR
    SULT1B1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1435-CF
    SULT1B1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1435-NF
    SULT1B1 cDNA ORF Clone, Mouse, C-His tag MG5A1435-CH
    SULT1B1 cDNA ORF Clone, Mouse, N-His tag MG5A1435-NH
    SULT1B1 cDNA ORF Clone, Mouse, C-HA tag MG5A1435-CY
    SULT1B1 cDNA ORF Clone, Mouse, N-HA tag MG5A1435-NY
    SULT1B1 cDNA ORF Clone, Mouse, C-Myc tag MG5A1435-CM
    SULT1B1 cDNA ORF Clone, Mouse, N-Myc tag MG5A1435-NM

    SULT1B1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SULT1B1 cDNA ORF Clone in Cloning Vector, Human HG11592-M
    SULT1B1 cDNA ORF Clone, Human, untagged HG11592-UT
    SULT1B1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11592-ACG
    SULT1B1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11592-ACGLN
    SULT1B1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11592-ANG
    SULT1B1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11592-ACR
    SULT1B1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11592-ANR
    SULT1B1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11592-CF
    SULT1B1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11592-NF
    SULT1B1 cDNA ORF Clone, Human, C-His tag HG11592-CH
    SULT1B1 cDNA ORF Clone, Human, N-His tag HG11592-NH
    SULT1B1 cDNA ORF Clone, Human, C-HA tag HG11592-CY
    SULT1B1 cDNA ORF Clone, Human, N-HA tag HG11592-NY
    SULT1B1 cDNA ORF Clone, Human, C-Myc tag HG11592-CM
    SULT1B1 qPCR Primer Pairs, Human HP101438
    info info
    添加购物车成功! 添加购物车失败!