Quick Order

Text Size:AAA

Human SULT1B1 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human SULT1B1 cDNA Clone Product Information
NCBI RefSeq:NM_014465.3
RefSeq ORF Size:891bp
cDNA Description:Full length Clone DNA of Homo sapiens sulfotransferase family, cytosolic, 1B, member 1 with N terminal Myc tag.
Gene Synonym:ST1B2, SULT1B2, MGC13356, SULT1B1
Species:Human
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Sulfotransferase family cytosolic 1B member 1, also known as Sulfotransferase 1B1, Sulfotransferase 1B2, Thyroid hormone sulfotransferase, SULT1B1 and ST1B2, is a cytoplasm protein which belongs to the sulfotransferase 1 family. Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. SULT1B1 is highly expressed in the liver, peripheral blood leukocytes, colon (mucosal lining), small intestine (jejunum) and spleen. A lesser expression of SULT1B1 was observed in the lung, placenta and thymus. SULT1B1 catalyzes the sulfate conjugation of many hormones, neurotransmitters, drugs and xenobiotic compounds. Sulfonation increases the water solubility of most compounds, and therefore their renal excretion, but it can also result in bioactivation to form active metabolites. SULT1B1 sulfates dopamine, small phenols such as 1-naphthol and p-nitrophenol and thyroid hormones, including 3,3'-diiodothyronine, triidothyronine, reverse triiodothyronine and thyroxine.

References
  • Fujita K. et al., 1997, J. Biochem. 122:1052-61.
  • Kester,MH.et al., 2003,Am J Physiol Endocrinol Metab. 285 (3):E592-8.
  • Meinl W, et al., 2001, Biochem Biophys Res Commun. 288 (4): 855-62.
  • Dombrovski L. et al., 2006, Proteins 64: 1091-4.
  • Size / Price
    Catalog: HG11592-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"