SULT1A3 cDNA ORF Clone, Human, N-His tag

Cat: HG11408-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SULT1A3 Reagents
CRO Services
Product recommended

All SULT1A3 Reagents
SULT1A3 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
888 bp
Description
Full length Clone DNA of Human angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SULT1A3 cDNA ORF Clone, Human, N-His tag Alternative Names
HAST cDNA ORF Clone, Human;HAST3 cDNA ORF Clone, Human;M-PST cDNA ORF Clone, Human;ST1A3 cDNA ORF Clone, Human;ST1A3/ST1A4 cDNA ORF Clone, Human;ST1A5 cDNA ORF Clone, Human;STM cDNA ORF Clone, Human;SULT1A3 cDNA ORF Clone, Human;SULT1A4 cDNA ORF Clone, Human;TL-PST cDNA ORF Clone, Human
SULT1A3 Background Information

SULT1A3 belongs to the sulfotransferase 1 family. Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. They are different in their tissue distributions and substrate specificities while their gene structure (number and length of exons) is similar. SULT1A3 gene encodes a phenol sulfotransferase with thermolabile enzyme activity. Four sulfotransferase genes are located on the p arm of chromosome 16; this gene and SULT1A4 arose from a segmental duplication. It is the most centromeric of the four sulfotransferase genes. Exons of this gene overlap with exons of a gene that encodes a protein containing GIY-YIG domains (GIYD1). SULT1A3 is expressed in liver, colon, kidney, lung, brain, spleen, small intestine, placenta and leukocyte. SULT1A3 is a sulfotransferase that utilizes 3'-phospho-5'-adenylyl sulfate (PAPS) as sulfonate donor to catalyze the sulfate conjugation of phenolic monoamines (neurotransmitters such as dopamine, norepinephrine and serotonin) and phenolic and catechol drugs.

Full Name
sulfotransferase family 1A member 3
References
  • Dajani R, et al. (1999) Kinetic properties of human dopamine sulfotransferase (SULT1A3) expressed in prokaryotic and eukaryotic systems: comparison with the recombinant enzyme purified from Escherichia coli. Protein Expr. Purif. 16 (1): 11-8.
  • Dajani R, et al. (2000) X-ray crystal structure of human dopamine sulfotransferase, SULT1A3. J. Biol. Chem. 274 (53): 37862-8.
  • Yasuda S, et al. (2011) Sulfation of chlorotyrosine and nitrotyrosine by human lung endothelial and epithelial cells: role of the human SULT1A3. Toxicol Appl Pharmacol. 251 (2): 104-9.
  • Hildebrandt MA, et al. (2004) Human SULT1A3 pharmacogenetics: gene duplication and functional genomic studies. Biochem Biophys Res Commun. 321 (4): 870-8.
  • Lu JH, et al. (2005) Crystal structure of human sulfotransferase SULT1A3 in complex with dopamine and 3'-phosphoadenosine 5'-phosphate. Biochem Biophys Res Commun. 335 (2): 417-23.
  • info info
    添加购物车成功! 添加购物车失败!