Quick Order

Text Size:AAA

Human SULT1A3 Gene ORF cDNA clone expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human SULT1A3 cDNA Clone Product Information
    NCBI RefSeq:NM_003166.3
    RefSeq ORF Size:888bp
    cDNA Description:Full length Clone DNA of Homo sapiens angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 with N terminal His tag.
    Gene Synonym:STM, HAST, HAST3, M-PST, ST1A5, TL-PST, SULT1A4, MGC117469, SULT1A3
    Species:Human
    Vector:pCMV3-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SULT1A3 qPCR primers for gene expression analysis, HP101286 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Background

    SULT1A3 belongs to the sulfotransferase 1 family. Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. They are different in their tissue distributions and substrate specificities while their gene structure (number and length of exons) is similar. SULT1A3 gene encodes a phenol sulfotransferase with thermolabile enzyme activity. Four sulfotransferase genes are located on the p arm of chromosome 16; this gene and SULT1A4 arose from a segmental duplication. It is the most centromeric of the four sulfotransferase genes. Exons of this gene overlap with exons of a gene that encodes a protein containing GIY-YIG domains (GIYD1). SULT1A3 is expressed in liver, colon, kidney, lung, brain, spleen, small intestine, placenta and leukocyte. SULT1A3 is a sulfotransferase that utilizes 3'-phospho-5'-adenylyl sulfate (PAPS) as sulfonate donor to catalyze the sulfate conjugation of phenolic monoamines (neurotransmitters such as dopamine, norepinephrine and serotonin) and phenolic and catechol drugs.

    References
  • Dajani R, et al. (1999) Kinetic properties of human dopamine sulfotransferase (SULT1A3) expressed in prokaryotic and eukaryotic systems: comparison with the recombinant enzyme purified from Escherichia coli. Protein Expr. Purif. 16 (1): 11-8.
  • Dajani R, et al. (2000) X-ray crystal structure of human dopamine sulfotransferase, SULT1A3. J. Biol. Chem. 274 (53): 37862-8.
  • Yasuda S, et al. (2011) Sulfation of chlorotyrosine and nitrotyrosine by human lung endothelial and epithelial cells: role of the human SULT1A3. Toxicol Appl Pharmacol. 251 (2): 104-9.
  • Hildebrandt MA, et al. (2004) Human SULT1A3 pharmacogenetics: gene duplication and functional genomic studies. Biochem Biophys Res Commun. 321 (4): 870-8.
  • Lu JH, et al. (2005) Crystal structure of human sulfotransferase SULT1A3 in complex with dopamine and 3'-phosphoadenosine 5'-phosphate. Biochem Biophys Res Commun. 335 (2): 417-23.
  • Size / Price
    Catalog: HG11408-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"