STYK1/NOK cDNA ORF Clone, Human, C-Myc tag

Cat: HG10722-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All STYK1/NOK Reagents
CRO Services
Product recommended

All STYK1/NOK Reagents
STYK1/NOK cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1269 bp
Description
Full length Clone DNA of Human serine/threonine/tyrosine kinase 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

STYK1/NOK cDNA ORF Clone, Human, C-Myc tag Alternative Names
NOK cDNA ORF Clone, Human;SuRTK106 cDNA ORF Clone, Human
STYK1/NOK Background Information
Full Name
serine/threonine/tyrosine kinase 1

STYK1/NOK cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
STYK1/NOK cDNA ORF Clone in Cloning Vector, Mouse MG50883-G
STYK1/NOK cDNA ORF Clone, Mouse, untagged MG50883-UT
STYK1/NOK cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50883-ACG
STYK1/NOK Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50883-ACGLN
STYK1/NOK cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50883-ACR
STYK1/NOK cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50883-CF
STYK1/NOK cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50883-NF
STYK1/NOK cDNA ORF Clone, Mouse, C-His tag MG50883-CH
STYK1/NOK cDNA ORF Clone, Mouse, N-His tag MG50883-NH
STYK1/NOK cDNA ORF Clone, Mouse, C-HA tag MG50883-CY
STYK1/NOK cDNA ORF Clone, Mouse, N-HA tag MG50883-NY
STYK1/NOK cDNA ORF Clone, Mouse, C-Myc tag MG50883-CM
STYK1/NOK cDNA ORF Clone, Mouse, N-Myc tag MG50883-NM
STYK1/NOK qPCR Primer Pairs, Mouse MP200854

STYK1/NOK cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
STYK1/NOK cDNA ORF Clone in Cloning Vector, Human HG10722-M
STYK1/NOK cDNA ORF Clone, Human, untagged HG10722-UT
STYK1/NOK cDNA ORF Clone, Human, C-GFPSpark® tag HG10722-ACG
STYK1/NOK Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10722-ACGLN
STYK1/NOK cDNA ORF Clone, Human, C-OFPSpark® tag HG10722-ACR
STYK1/NOK cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10722-CF
STYK1/NOK cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10722-NF
STYK1/NOK cDNA ORF Clone, Human, C-His tag HG10722-CH
STYK1/NOK cDNA ORF Clone, Human, N-His tag HG10722-NH
STYK1/NOK cDNA ORF Clone, Human, C-HA tag HG10722-CY
STYK1/NOK cDNA ORF Clone, Human, N-HA tag HG10722-NY
STYK1/NOK cDNA ORF Clone, Human, N-Myc tag HG10722-NM
STYK1/NOK qPCR Primer Pairs, Human HP100661
info info
添加购物车成功! 添加购物车失败!