Syntaxin 6 cDNA ORF Clone, Human, C-Myc tag

Cat: HG11246-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Syntaxin 6 Reagents

CRO Services

Product recommended


All Syntaxin 6 Reagents

Syntaxin 6 cDNA ORF Clone, Human, C-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
813 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 651T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human syntaxin 6 with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + NotI(6kb+0.81kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Syntaxin 6 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Syntaxin 6 cDNA ORF Clone, Human, C-Myc tag Validated Images

Human IL12A / IL-12A Gene Plasmid Map 5644

Syntaxin 6 Background Information

Full Name
syntaxin 6

Syntaxin 6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Syntaxin 6 cDNA ORF Clone in Cloning Vector, Mouse MG52708-G
Syntaxin 6 cDNA ORF Clone, Mouse, untagged MG52708-UT
Syntaxin 6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52708-ACGLN
Syntaxin 6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52708-ACG
Syntaxin 6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52708-ACR
Syntaxin 6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52708-CF
Syntaxin 6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52708-NF
Syntaxin 6 cDNA ORF Clone, Mouse, C-His tag MG52708-CH
Syntaxin 6 cDNA ORF Clone, Mouse, N-His tag MG52708-NH
Syntaxin 6 cDNA ORF Clone, Mouse, C-HA tag MG52708-CY
Syntaxin 6 cDNA ORF Clone, Mouse, N-HA tag MG52708-NY
Syntaxin 6 cDNA ORF Clone, Mouse, C-Myc tag MG52708-CM
Syntaxin 6 cDNA ORF Clone, Mouse, N-Myc tag MG52708-NM
Syntaxin 6 qPCR Primer Pairs, Mouse MP202579

Syntaxin 6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Syntaxin 6 cDNA ORF Clone in Cloning Vector, Human HG11246-M
Syntaxin 6 cDNA ORF Clone, Human, untagged HG11246-UT
Syntaxin 6 cDNA ORF Clone, Human, C-GFPSpark® tag HG11246-ACG
Syntaxin 6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11246-ACGLN
Syntaxin 6 cDNA ORF Clone, Human, N-GFPSpark® tag HG11246-ANG
Syntaxin 6 cDNA ORF Clone, Human, C-OFPSpark® tag HG11246-ACR
Syntaxin 6 cDNA ORF Clone, Human, N-OFPSpark® tag HG11246-ANR
Syntaxin 6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11246-CF
Syntaxin 6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11246-NF
Syntaxin 6 cDNA ORF Clone, Human, C-His tag HG11246-CH
Syntaxin 6 cDNA ORF Clone, Human, N-His tag HG11246-NH
Syntaxin 6 cDNA ORF Clone, Human, C-HA tag HG11246-CY
Syntaxin 6 cDNA ORF Clone, Human, N-HA tag HG11246-NY
Syntaxin 6 cDNA ORF Clone, Human, N-Myc tag HG11246-NM
Syntaxin 6 qPCR Primer Pairs, Human HP101130
info info
添加购物车成功! 添加购物车失败!