After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human STX3 / Syntaxin 3 Gene ORF cDNA clone expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human STX3 cDNA Clone Product Information
NCBI RefSeq:BC007405
RefSeq ORF Size:870bp
cDNA Description:Full length Clone DNA of Homo sapiens syntaxin 3 with N terminal Flag tag.
Gene Synonym:STX3A
Species:Human
Vector:pCMV3-N-FLAG
Plasmid:pCMV3-Flag-STX3
Restriction Site:KpnI + XbaI (6kb + 0.91kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human STX3 Gene Plasmid Map
Human STX3 natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

STX3, also known as syntaxin 3, belongs to the syntaxin family. STX3 is a target membrane protein (t-SNARE) which is needed for membrane fusion. Membrane fusion requires the formation of a complex between a vesicle protein (v-SNARE) and t-SNAREs. STX3, together with syntaxin 2, are predominantly localized at the plasma membrane. Syntaxin 2 cycles between the plasma membrane and the perinuclear compartment whereas syntaxin 3 cycles between the plasma membrane and the trans-Golgi network. It is possible that this cycling has an important role in the regulation of t-SNARE function.

References
  • Ibaraki K. et al., 1995, Biochem Biophys Res Commun. 211 (3): 997-1005
  • Martín-Martín B. et al., 1999, J Leukoc Biol. 65 (3): 397-406.
  • Darios F. et al., 2006, Nature. 440 (7085): 813-7.
  • Size / Price
    Catalog: HG14625-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human STX3 natural ORF mammalian expression plasmid, N-Flag tag
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"