STRAP cDNA ORF Clone, Human, untagged

Cat: HG14218-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All STRAP Reagents

CRO Services

Product recommended


All STRAP Reagents

STRAP cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1053 bp
Description
Full length Clone DNA of Human serine/threonine kinase receptor associated protein.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

STRAP cDNA ORF Clone, Human, untagged Alternative Names

MAWD cDNA ORF Clone, Human;PT-WD cDNA ORF Clone, Human;UNRIP cDNA ORF Clone, Human

STRAP Background Information

Full Name
serine/threonine kinase receptor associated protein

STRAP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
STRAP cDNA ORF Clone in Cloning Vector, Mouse MG51926-G
STRAP cDNA ORF Clone, Mouse, untagged MG51926-UT
STRAP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51926-ACG
STRAP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51926-ACGLN
STRAP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51926-ANG
STRAP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51926-ACR
STRAP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51926-ANR
STRAP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51926-CF
STRAP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51926-NF
STRAP cDNA ORF Clone, Mouse, C-His tag MG51926-CH
STRAP cDNA ORF Clone, Mouse, N-His tag MG51926-NH
STRAP cDNA ORF Clone, Mouse, C-HA tag MG51926-CY
STRAP cDNA ORF Clone, Mouse, N-HA tag MG51926-NY
STRAP cDNA ORF Clone, Mouse, C-Myc tag MG51926-CM
STRAP cDNA ORF Clone, Mouse, N-Myc tag MG51926-NM
STRAP qPCR Primer Pairs, Mouse MP201799

STRAP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
STRAP cDNA ORF Clone in Cloning Vector, Human HG14218-G
STRAP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14218-ACGLN
STRAP cDNA ORF Clone, Human, C-GFPSpark® tag HG14218-ACG
STRAP cDNA ORF Clone, Human, N-GFPSpark® tag HG14218-ANG
STRAP cDNA ORF Clone, Human, C-OFPSpark® tag HG14218-ACR
STRAP cDNA ORF Clone, Human, N-OFPSpark® tag HG14218-ANR
STRAP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14218-CF
STRAP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14218-NF
STRAP cDNA ORF Clone, Human, C-His tag HG14218-CH
STRAP cDNA ORF Clone, Human, N-His tag HG14218-NH
STRAP cDNA ORF Clone, Human, C-HA tag HG14218-CY
STRAP cDNA ORF Clone, Human, N-HA tag HG14218-NY
STRAP cDNA ORF Clone, Human, C-Myc tag HG14218-CM
STRAP cDNA ORF Clone, Human, N-Myc tag HG14218-NM
STRAP qPCR Primer Pairs, Human HP102868
info info
添加购物车成功! 添加购物车失败!