Stomatin cDNA ORF Clone, Human, N-HA tag

Cat: HG14624-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Stomatin Reagents

CRO Services

Product recommended


All Stomatin Reagents

Stomatin cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
867 bp
Description
Full length Clone DNA of Human stomatin with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Stomatin cDNA ORF Clone, Human, N-HA tag Alternative Names

BND7 cDNA ORF Clone, Human;EPB7 cDNA ORF Clone, Human;EPB72 cDNA ORF Clone, Human

Stomatin Background Information

Full Name
stomatin

Stomatin cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Stomatin cDNA ORF Clone in Cloning Vector, Rat RG88091-U
Stomatin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG88091-ACGLN

Stomatin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Stomatin cDNA ORF Clone in Cloning Vector, Mouse MG53293-U
Stomatin cDNA ORF Clone, Mouse, untagged MG53293-UT
Stomatin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53293-ACG
Stomatin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53293-ACGLN
Stomatin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53293-ACR
Stomatin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53293-CF
Stomatin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53293-NF
Stomatin cDNA ORF Clone, Mouse, C-His tag MG53293-CH
Stomatin cDNA ORF Clone, Mouse, N-His tag MG53293-NH
Stomatin cDNA ORF Clone, Mouse, C-HA tag MG53293-CY
Stomatin cDNA ORF Clone, Mouse, N-HA tag MG53293-NY
Stomatin cDNA ORF Clone, Mouse, C-Myc tag MG53293-CM
Stomatin cDNA ORF Clone, Mouse, N-Myc tag MG53293-NM

Stomatin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Stomatin cDNA ORF Clone in Cloning Vector, Human HG14624-G
Stomatin cDNA ORF Clone, Human, untagged HG14624-UT
Stomatin cDNA ORF Clone, Human, C-GFPSpark® tag HG14624-ACG
Stomatin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14624-ACGLN
Stomatin cDNA ORF Clone, Human, C-OFPSpark® tag HG14624-ACR
Stomatin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14624-CF
Stomatin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14624-NF
Stomatin cDNA ORF Clone, Human, C-His tag HG14624-CH
Stomatin cDNA ORF Clone, Human, N-His tag HG14624-NH
Stomatin cDNA ORF Clone, Human, C-HA tag HG14624-CY
Stomatin cDNA ORF Clone, Human, C-Myc tag HG14624-CM
Stomatin cDNA ORF Clone, Human, N-Myc tag HG14624-NM
Stomatin qPCR Primer Pairs, Human HP103258
info info
添加购物车成功! 添加购物车失败!