Stomatin cDNA ORF Clone, Human, C-His tag

Cat: HG14624-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Stomatin Reagents
CRO Services
Product recommended

All Stomatin Reagents
Stomatin cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
867 bp
Description
Full length Clone DNA of Human stomatin with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Stomatin cDNA ORF Clone, Human, C-His tag Alternative Names
BND7 cDNA ORF Clone, Human;EPB7 cDNA ORF Clone, Human;EPB72 cDNA ORF Clone, Human
Stomatin Background Information
Full Name
stomatin

Stomatin cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Stomatin cDNA ORF Clone in Cloning Vector, Rat RG88091-U
Stomatin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG88091-ACGLN

Stomatin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Stomatin cDNA ORF Clone in Cloning Vector, Mouse MG53293-U
Stomatin cDNA ORF Clone, Mouse, untagged MG53293-UT
Stomatin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53293-ACGLN
Stomatin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53293-ACG
Stomatin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53293-ACR
Stomatin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53293-CF
Stomatin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53293-NF
Stomatin cDNA ORF Clone, Mouse, C-His tag MG53293-CH
Stomatin cDNA ORF Clone, Mouse, N-His tag MG53293-NH
Stomatin cDNA ORF Clone, Mouse, C-HA tag MG53293-CY
Stomatin cDNA ORF Clone, Mouse, N-HA tag MG53293-NY
Stomatin cDNA ORF Clone, Mouse, C-Myc tag MG53293-CM
Stomatin cDNA ORF Clone, Mouse, N-Myc tag MG53293-NM

Stomatin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Stomatin cDNA ORF Clone in Cloning Vector, Human HG14624-G
Stomatin cDNA ORF Clone, Human, untagged HG14624-UT
Stomatin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14624-ACGLN
Stomatin cDNA ORF Clone, Human, C-GFPSpark® tag HG14624-ACG
Stomatin cDNA ORF Clone, Human, C-OFPSpark® tag HG14624-ACR
Stomatin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14624-CF
Stomatin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14624-NF
Stomatin cDNA ORF Clone, Human, N-His tag HG14624-NH
Stomatin cDNA ORF Clone, Human, C-HA tag HG14624-CY
Stomatin cDNA ORF Clone, Human, N-HA tag HG14624-NY
Stomatin cDNA ORF Clone, Human, C-Myc tag HG14624-CM
Stomatin cDNA ORF Clone, Human, N-Myc tag HG14624-NM
Stomatin qPCR Primer Pairs, Human HP103258
info info
添加购物车成功! 添加购物车失败!