STMN2 cDNA ORF Clone, Human, N-Myc tag

Cat: HG14986-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All STMN2 Reagents
CRO Services
Product recommended

All STMN2 Reagents
STMN2 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
540 bp
Description
Full length Clone DNA of Human stathmin-like 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

STMN2 cDNA ORF Clone, Human, N-Myc tag Alternative Names
SCG10 cDNA ORF Clone, Human;SCGN10 cDNA ORF Clone, Human
STMN2 Background Information
Full Name
stathmin 2

STMN2 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
STMN2 cDNA ORF Clone in Cloning Vector, Rhesus CG90569-G
STMN2 cDNA ORF Clone, Rhesus, untagged CG90569-UT
STMN2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90569-ACGLN
STMN2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90569-ACG
STMN2 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90569-ANG
STMN2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90569-ACR
STMN2 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90569-ANR
STMN2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90569-CF
STMN2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90569-NF
STMN2 cDNA ORF Clone, Rhesus, C-His tag CG90569-CH
STMN2 cDNA ORF Clone, Rhesus, N-His tag CG90569-NH
STMN2 cDNA ORF Clone, Rhesus, C-HA tag CG90569-CY
STMN2 cDNA ORF Clone, Rhesus, N-HA tag CG90569-NY
STMN2 cDNA ORF Clone, Rhesus, C-Myc tag CG90569-CM
STMN2 cDNA ORF Clone, Rhesus, N-Myc tag CG90569-NM

STMN2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
STMN2 cDNA ORF Clone in Cloning Vector, Human HG14986-G
STMN2 cDNA ORF Clone, Human, untagged HG14986-UT
STMN2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14986-ACGLN
STMN2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14986-ACG
STMN2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14986-ANG
STMN2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14986-ACR
STMN2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14986-ANR
STMN2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14986-CF
STMN2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14986-NF
STMN2 cDNA ORF Clone, Human, C-His tag HG14986-CH
STMN2 cDNA ORF Clone, Human, N-His tag HG14986-NH
STMN2 cDNA ORF Clone, Human, C-HA tag HG14986-CY
STMN2 cDNA ORF Clone, Human, N-HA tag HG14986-NY
STMN2 cDNA ORF Clone, Human, C-Myc tag HG14986-CM
STMN2 qPCR Primer Pairs, Human HP103614
info info
添加购物车成功! 添加购物车失败!