STK40 cDNA ORF Clone, Human, N-Myc tag

Cat: HG11597-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All STK40 Reagents
CRO Services
Product recommended

All STK40 Reagents
STK40 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1308 bp
Description
Full length Clone DNA of Human serine/threonine kinase 40 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

STK40 cDNA ORF Clone, Human, N-Myc tag Alternative Names
SgK495 cDNA ORF Clone, Human;SHIK cDNA ORF Clone, Human
STK40 Background Information

STK40 localized to both the cytoplasm and the nucleus. It is ubiquitously expressed. Mechanistically, Stk40 interacts with Rcn2, which also activates Erk1/2 to induce ExEn specification in mouse ESCs. Stk40 is able to activate the Erk/MAPK pathway and induce extraembryonic-endoderm (ExEn) differentiation in mouse ESCs. Interestingly, cells overexpressing Stk40 exclusively contribute to the ExEn layer of chimeric embryos when injected into host blastocysts. In contrast, deletion of Stk40 in ESCs markedly reduces ExEn differentiation in vitro. STK40 has a central serine/threonine protein kinase domain and is homologous to TRB-3, a protein that regulates activation of MAP kinases and inhibits NFκB-mediated gene transcription. Similarly, overexpression of STK40 inhibits NFκB activation triggered by TNF and also inhibits p53-mediated transcription. There are four named isoforms of STK40 that are produced as a result of alternative splicing.

Full Name
serine/threonine kinase 40
References
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Wiemann S, et al. (2001) Toward a catalog of human genes and proteins: sequencing and analysis of 500 novel complete protein coding human cDNAs. Genome Res. 11(3):422-35.
  • Hartley JL, et al. (2001) DNA cloning using in vitro site-specific recombination. Genome Res. 10(11): 1788-95.
  • info info
    添加购物车成功! 添加购物车失败!