Quick Order

Human STK40 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human STK40 cDNA Clone Product Information
NCBI RefSeq:NM_032017.1
RefSeq ORF Size:1308bp
cDNA Description:Full length Clone DNA of Homo sapiens serine/threonine kinase 40 with N terminal Myc tag.
Gene Synonym:SHIK, SgK495, MGC4796, RP11-268J15.4
Species:Human
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

STK40 localized to both the cytoplasm and the nucleus. It is ubiquitously expressed. Mechanistically, Stk40 interacts with Rcn2, which also activates Erk1/2 to induce ExEn specification in mouse ESCs. Stk40 is able to activate the Erk/MAPK pathway and induce extraembryonic-endoderm (ExEn) differentiation in mouse ESCs. Interestingly, cells overexpressing Stk40 exclusively contribute to the ExEn layer of chimeric embryos when injected into host blastocysts. In contrast, deletion of Stk40 in ESCs markedly reduces ExEn differentiation in vitro. STK40 has a central serine/threonine protein kinase domain and is homologous to TRB-3, a protein that regulates activation of MAP kinases and inhibits NFκB-mediated gene transcription. Similarly, overexpression of STK40 inhibits NFκB activation triggered by TNF and also inhibits p53-mediated transcription. There are four named isoforms of STK40 that are produced as a result of alternative splicing.

References
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Wiemann S, et al. (2001) Toward a catalog of human genes and proteins: sequencing and analysis of 500 novel complete protein coding human cDNAs. Genome Res. 11(3):422-35.
  • Hartley JL, et al. (2001) DNA cloning using in vitro site-specific recombination. Genome Res. 10(11): 1788-95.
  • Size / Price
    Catalog: HG11597-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"