STK25 cDNA ORF Clone, Human, C-HA tag

Cat: HG10652-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All STK25 Reagents
CRO Services
Product recommended

All STK25 Reagents
STK25 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1281 bp
Description
Full length Clone DNA of Human serine/threonine kinase 25 (STE20 homolog, yeast) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

STK25 cDNA ORF Clone, Human, C-HA tag Alternative Names
SOK1 cDNA ORF Clone, Human;YSK1 cDNA ORF Clone, Human
STK25 Background Information
Full Name
serine/threonine kinase 25

STK25 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
STK25 cDNA ORF Clone in Cloning Vector, Rat RG86190-U
STK25 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG86190-ACGLN

STK25 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
STK25 cDNA ORF Clone in Cloning Vector, Mouse MG50904-G
STK25 cDNA ORF Clone, Mouse, untagged MG50904-UT
STK25 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50904-ACGLN
STK25 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50904-ACG
STK25 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50904-ANG
STK25 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50904-ACR
STK25 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50904-ANR
STK25 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50904-CF
STK25 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50904-NF
STK25 cDNA ORF Clone, Mouse, C-His tag MG50904-CH
STK25 cDNA ORF Clone, Mouse, N-His tag MG50904-NH
STK25 cDNA ORF Clone, Mouse, C-HA tag MG50904-CY
STK25 cDNA ORF Clone, Mouse, N-HA tag MG50904-NY
STK25 cDNA ORF Clone, Mouse, C-Myc tag MG50904-CM
STK25 cDNA ORF Clone, Mouse, N-Myc tag MG50904-NM
STK25 qPCR Primer Pairs, Mouse MP200875

STK25 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
STK25 cDNA ORF Clone in Cloning Vector, Human HG10652-M
STK25 cDNA ORF Clone, Human, untagged HG10652-UT
STK25 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10652-ACGLN
STK25 cDNA ORF Clone, Human, C-GFPSpark® tag HG10652-ACG
STK25 cDNA ORF Clone, Human, N-GFPSpark® tag HG10652-ANG
STK25 cDNA ORF Clone, Human, C-OFPSpark® tag HG10652-ACR
STK25 cDNA ORF Clone, Human, N-OFPSpark® tag HG10652-ANR
STK25 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10652-CF
STK25 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10652-NF
STK25 cDNA ORF Clone, Human, C-His tag HG10652-CH
STK25 cDNA ORF Clone, Human, N-His tag HG10652-NH
STK25 cDNA ORF Clone, Human, N-HA tag HG10652-NY
STK25 cDNA ORF Clone, Human, C-Myc tag HG10652-CM
STK25 cDNA ORF Clone, Human, N-Myc tag HG10652-NM
STK25 qPCR Primer Pairs, Human HP100624
info info
添加购物车成功! 添加购物车失败!