STK16 cDNA ORF Clone, Human, N-HA tag

Cat: HG12201-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All STK16 Reagents
CRO Services
Product recommended

All STK16 Reagents
STK16 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
918 bp
Description
Full length Clone DNA of Human serine/threonine kinase 16 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

STK16 cDNA ORF Clone, Human, N-HA tag Alternative Names
KRCT cDNA ORF Clone, Human;MPSK cDNA ORF Clone, Human;PKL12 cDNA ORF Clone, Human;TSF1 cDNA ORF Clone, Human
STK16 Background Information

Serine/threonine-protein kinase 16, also known as myristoylated and palmitoylated serine/threonine-protein kinase, Protein kinase PKL12, TGF-beta-stimulated factor 1, TSF-1, MPSK1 and STK16, is a membrane protein which is ubiquitously expressed at very low levels. STK16 / MPSK1 belongs to the protein kinase superfamily and Ser/Thr protein kinase family. It contains one protein kinase domain. Transforming growth factor-beta (TGF-beta) shows a variety of biological activities in various organs or cells. Some factors such as Smads (Sma and Mad proteins) and TGF-beta activating kinase 1 have been characterized as signalling molecules downstream of TGF-beta. Several TGF-beta response elements have been identified such as cAMP response element, Smad binding element, and recognition sites for activating protein-1 and stimulating protein-1 in various gene promoters. STK16 / MPSK1 is an unique factor with two biological functions, transcriptional regulation and protein phosphorylation, that may be involved in TGF-beta signals. STK16 / MPSK1 is a protein kinase that act on both serine and threonine residues. STK16 / MPSK1 possessed DNA-binding ability and activated the TGF-beta responsive CNP promoter or vascular endothelial growth factor gene promoter which possesses a sequence element analogous to the TGF-beta responsive GC-rich element of the CNP promoter. STK16 / MPSK1 did not directly activate a Smads-dependent promoter from plasminogen activator inhibitor 1 gene, but it showed enhancement in co-operation with Smad3 and Smad4. STK16 / MPSK1 mRNA as well as its protein level were stimulated by TGF-beta treatment.

Full Name
serine/threonine kinase 16
References
  • Ligos J.M., et al., 1998, Biochem. Biophys. Res.Commun. 249:380-4.
  • Berson A.E., et al.,1999, Biochem. Biophys. Res. Commun. 259:533-8.
  • Ohta S., et al., 2000, Biochem. J. 350:395-404.
  • Guinea,B. et al., 2006, Exp Cell Res. 312 (2):135-44. 
  • info info
    添加购物车成功! 添加购物车失败!