After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human STK16/PKL12 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human STK16 cDNA Clone Product Information
NCBI RefSeq:BC002618
RefSeq ORF Size:918bp
cDNA Description:Full length Clone DNA of Homo sapiens serine/threonine kinase 16 with C terminal His tag.
Gene Synonym:KRCT, MPSK, TSF1, PKL12, STK16
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Serine/threonine-protein kinase 16, also known as myristoylated and palmitoylated serine/threonine-protein kinase, Protein kinase PKL12, TGF-beta-stimulated factor 1, TSF-1, MPSK1 and STK16, is a membrane protein which is ubiquitously expressed at very low levels. STK16 / MPSK1 belongs to the protein kinase superfamily and Ser/Thr protein kinase family. It contains one protein kinase domain. Transforming growth factor-beta (TGF-beta) shows a variety of biological activities in various organs or cells. Some factors such as Smads (Sma and Mad proteins) and TGF-beta activating kinase 1 have been characterized as signalling molecules downstream of TGF-beta. Several TGF-beta response elements have been identified such as cAMP response element, Smad binding element, and recognition sites for activating protein-1 and stimulating protein-1 in various gene promoters. STK16 / MPSK1 is an unique factor with two biological functions, transcriptional regulation and protein phosphorylation, that may be involved in TGF-beta signals. STK16 / MPSK1 is a protein kinase that act on both serine and threonine residues. STK16 / MPSK1 possessed DNA-binding ability and activated the TGF-beta responsive CNP promoter or vascular endothelial growth factor gene promoter which possesses a sequence element analogous to the TGF-beta responsive GC-rich element of the CNP promoter. STK16 / MPSK1 did not directly activate a Smads-dependent promoter from plasminogen activator inhibitor 1 gene, but it showed enhancement in co-operation with Smad3 and Smad4. STK16 / MPSK1 mRNA as well as its protein level were stimulated by TGF-beta treatment.

References
  • Ligos J.M., et al., 1998, Biochem. Biophys. Res.Commun. 249:380-4.
  • Berson A.E., et al.,1999, Biochem. Biophys. Res. Commun. 259:533-8.
  • Ohta S., et al., 2000, Biochem. J. 350:395-404.
  • Guinea,B. et al., 2006, Exp Cell Res. 312 (2):135-44. 
  • Size / Price
    Catalog: HG12201-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"