After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human STC2 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human STC2 cDNA Clone Product Information
NCBI RefSeq:BC000658
RefSeq ORF Size:909bp
cDNA Description:Full length Clone DNA of Homo sapiens stanniocalcin 2 with N terminal His tag.
Gene Synonym:STC-2, STCRP, STC2
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

STC2 is a secreted, homodimeric glycoprotein which expressed in a wide variety of tissues. STC2 has an anti-hypocalcemic action on calcium and phosphate homeostasis. It may have autocrine or paracrine functions. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. STC2 has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. It may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis.

References
  • Chang AC, et al. (1998) Identification of a second stanniocalcin cDNA in mouse and human: stanniocalcin 2. Mol Cell Endocrinol. 141(1-2):95-9.
  • Ishibashi K, et al. (1998) Molecular cloning of a second human stanniocalcin homologue (STC2). Biochem Biophys Res Commun. 250(2):252-8.
  • uo CW, et al. (2005) Identification of a stanniocalcin paralog, stanniocalcin-2, in fish and the paracrine actions of stanniocalcin-2 in the mammalian ovary. Endocrinology. 146(1):469-76.
  • Size / Price
    Catalog: HG13653-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"