Quick Order

Text Size:AAA

Human Statherin / STATH Gene ORF cDNA clone expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human STATH cDNA Clone Product Information
    NCBI RefSeq:NM_003154.2
    RefSeq ORF Size:189bp
    cDNA Description:Full length Clone DNA of Homo sapiens statherin with N terminal His tag.
    Gene Synonym:STR, STATH
    Species:Human
    Vector:pCMV3-SP-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with STATH qPCR primers for gene expression analysis, HP102373 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Background

    Statherin, also known as STATH, belongs to the histatin/statherin family. Statherin may play an important role in the maintenance of oral health.It prevents calcium phospate precipitation in saliva, so maintaining a high calcium level in saliva and preventing teeth from dissolving. Statherin also inhibits spontaneous precipitation of calcium phosphate salts. Thus, statherin and PRPs may prevent build-up of harmful deposits in the salivary glands and on the tooth surfaces.Statherin is a highly stable salivary protein of low molecular mass (5,380). Sabatini et al. synthesized mixed oligonucleotides based on the known amino acid sequence of statherin and used these to screen a cDNA library constructed from human parotid gland mRNA.

    References
  • Sabatini LM. et al., 1998, Am J Hum Genet. 41 (6): 1048-60.
  • Schlesinger DH. et al., 1997, J Biol Chem. 252 (5): 1689-95.
  • Raj PA. et al., 1992, J Biol Chem. 267 (9): 5968-76.
  • Douglas WH. et al., 1991, Biochem Biophys Res Commun. 180 (1): 91-7.
  • Size / Price
    Catalog: HG13694-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"