After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Statherin / STATH Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human STATH cDNA Clone Product Information
NCBI RefSeq:NM_003154.2
RefSeq ORF Size:189bp
cDNA Description:Full length Clone DNA of Homo sapiens statherin with N terminal His tag.
Gene Synonym:STR, STATH
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Statherin, also known as STATH, belongs to the histatin/statherin family. Statherin may play an important role in the maintenance of oral health.It prevents calcium phospate precipitation in saliva, so maintaining a high calcium level in saliva and preventing teeth from dissolving. Statherin also inhibits spontaneous precipitation of calcium phosphate salts. Thus, statherin and PRPs may prevent build-up of harmful deposits in the salivary glands and on the tooth surfaces.Statherin is a highly stable salivary protein of low molecular mass (5,380). Sabatini et al. synthesized mixed oligonucleotides based on the known amino acid sequence of statherin and used these to screen a cDNA library constructed from human parotid gland mRNA.

References
  • Sabatini LM. et al., 1998, Am J Hum Genet. 41 (6): 1048-60.
  • Schlesinger DH. et al., 1997, J Biol Chem. 252 (5): 1689-95.
  • Raj PA. et al., 1992, J Biol Chem. 267 (9): 5968-76.
  • Douglas WH. et al., 1991, Biochem Biophys Res Commun. 180 (1): 91-7.
  • Size / Price
    Catalog: HG13694-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"