STAT2 cDNA ORF Clone, Human, N-HA tag

Cat: HG10547-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All STAT2 Reagents
CRO Services
Product recommended

All STAT2 Reagents
STAT2 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2556 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human signal transducer and activator of transcription 2, 113kDa with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Restriction Sites
KpnI + XbaI (6kb+2.60kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
STAT2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

STAT2 cDNA ORF Clone, Human, N-HA tag Validated Images
Cynomolgus LOC101926731 Gene Plasmid Map 5628
STAT2 cDNA ORF Clone, Human, N-HA tag Alternative Names
ISGF-3 cDNA ORF Clone, Human;P113 cDNA ORF Clone, Human;STAT113 cDNA ORF Clone, Human
STAT2 Background Information
Full Name
signal transducer and activator of transcription 2, 113kDa

STAT2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
STAT2 cDNA ORF Clone in Cloning Vector, Rat RG80596-U
STAT2 cDNA ORF Clone, Rat, untagged RG80596-UT
STAT2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80596-ACG
STAT2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80596-ACGLN
STAT2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80596-ANG
STAT2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80596-ACR
STAT2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80596-ANR
STAT2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80596-CF
STAT2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80596-NF
STAT2 cDNA ORF Clone, Rat, C-His tag RG80596-CH
STAT2 cDNA ORF Clone, Rat, N-His tag RG80596-NH
STAT2 cDNA ORF Clone, Rat, C-HA tag RG80596-CY
STAT2 cDNA ORF Clone, Rat, N-HA tag RG80596-NY
STAT2 cDNA ORF Clone, Rat, C-Myc tag RG80596-CM
STAT2 cDNA ORF Clone, Rat, N-Myc tag RG80596-NM
STAT2 qPCR Primer Pairs, Rat RP300560

STAT2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
STAT2 cDNA ORF Clone in Cloning Vector, Human HG10547-M
STAT2 cDNA ORF Clone, Human, untagged HG10547-UT
STAT2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10547-ACG
STAT2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10547-ACGLN
STAT2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10547-ANG
STAT2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10547-ACR
STAT2 cDNA ORF Clone, Human, N-OFPSpark® tag HG10547-ANR
STAT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10547-CF
STAT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10547-NF
STAT2 cDNA ORF Clone, Human, C-His tag HG10547-CH
STAT2 cDNA ORF Clone, Human, N-His tag HG10547-NH
STAT2 cDNA ORF Clone, Human, C-HA tag HG10547-CY
STAT2 cDNA ORF Clone, Human, C-Myc tag HG10547-CM
STAT2 cDNA ORF Clone, Human, N-Myc tag HG10547-NM
STAT2 qPCR Primer Pairs, Human HP100563
info info
添加购物车成功! 添加购物车失败!