ST6GALNAC2 cDNA ORF Clone, Human, untagged

Cat: HG15315-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ST6GALNAC2 Reagents
CRO Services
Product recommended

All ST6GALNAC2 Reagents
ST6GALNAC2 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1125 bp
Description
Full length Clone DNA of Human ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ST6GALNAC2 cDNA ORF Clone, Human, untagged Alternative Names
SAITL1 cDNA ORF Clone, Human;SIAT7 cDNA ORF Clone, Human;SIAT7B cDNA ORF Clone, Human;SIATL1 cDNA ORF Clone, Human;ST6GalNAII cDNA ORF Clone, Human;STHM cDNA ORF Clone, Human
ST6GALNAC2 Background Information
Full Name
ST6-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
References
  • Li GS, et al. (2007) Variants of the ST6GALNAC2 promoter influence transcriptional activity and contribute to genetic susceptibility to IgA nephropathy. Hum Mutat. 28(10): 950-7.
  • Ding JX, et al. (2009) Activity of alpha2,6-sialyltransferase and its gene expression in peripheral B lymphocytes in patients with IgA nephropathy. Scand J Immunol. 69(2): 174-80.
  • Kiryluk K, et al. (2010) Genetic studies of IgA nephropathy: past, present, and future. Pediatr Nephrol. 25(11): 2257-68.
  • ST6GALNAC2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ST6GALNAC2 cDNA ORF Clone in Cloning Vector, Mouse MG50774-G
    ST6GALNAC2 cDNA ORF Clone, Mouse, untagged MG50774-UT
    ST6GALNAC2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50774-ACGLN
    ST6GALNAC2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50774-ACG
    ST6GALNAC2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50774-ACR
    ST6GALNAC2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50774-CF
    ST6GALNAC2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50774-NF
    ST6GALNAC2 cDNA ORF Clone, Mouse, C-His tag MG50774-CH
    ST6GALNAC2 cDNA ORF Clone, Mouse, N-His tag MG50774-NH
    ST6GALNAC2 cDNA ORF Clone, Mouse, C-HA tag MG50774-CY
    ST6GALNAC2 cDNA ORF Clone, Mouse, N-HA tag MG50774-NY
    ST6GALNAC2 cDNA ORF Clone, Mouse, C-Myc tag MG50774-CM
    ST6GALNAC2 cDNA ORF Clone, Mouse, N-Myc tag MG50774-NM
    ST6GALNAC2 qPCR Primer Pairs, Mouse MP200748

    ST6GALNAC2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ST6GALNAC2 cDNA ORF Clone in Cloning Vector, Human HG15315-G
    ST6GALNAC2 cDNA ORF Clone, Human, C-GFPSpark® tag HG15315-ACG
    ST6GALNAC2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15315-ACGLN
    ST6GALNAC2 cDNA ORF Clone, Human, C-OFPSpark® tag HG15315-ACR
    ST6GALNAC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15315-CF
    ST6GALNAC2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15315-NF
    ST6GALNAC2 cDNA ORF Clone, Human, C-His tag HG15315-CH
    ST6GALNAC2 cDNA ORF Clone, Human, N-His tag HG15315-NH
    ST6GALNAC2 cDNA ORF Clone, Human, C-HA tag HG15315-CY
    ST6GALNAC2 cDNA ORF Clone, Human, N-HA tag HG15315-NY
    ST6GALNAC2 cDNA ORF Clone, Human, C-Myc tag HG15315-CM
    ST6GALNAC2 cDNA ORF Clone, Human, N-Myc tag HG15315-NM
    ST6GALNAC2 qPCR Primer Pairs, Human HP103940
    info info
    添加购物车成功! 添加购物车失败!