Quick Order

Human ST6GALNAC2/ST6GalNAcII Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human ST6GALNAC2 cDNA Clone Product Information
NCBI RefSeq:BC040455
RefSeq ORF Size:1125bp
cDNA Description:Full length Clone DNA of Homo sapiens ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2 DNA.
Gene Synonym:STHM, SIAT7, SAITL1, SIAT7B, SIATL1, ST6GalNAII
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ST6GALNAC2 qPCR primers for gene expression analysis, HP103940 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Li GS, et al. (2007) Variants of the ST6GALNAC2 promoter influence transcriptional activity and contribute to genetic susceptibility to IgA nephropathy. Hum Mutat. 28(10): 950-7.
  • Ding JX, et al. (2009) Activity of alpha2,6-sialyltransferase and its gene expression in peripheral B lymphocytes in patients with IgA nephropathy. Scand J Immunol. 69(2): 174-80.
  • Kiryluk K, et al. (2010) Genetic studies of IgA nephropathy: past, present, and future. Pediatr Nephrol. 25(11): 2257-68.
  • Size / Price
    Catalog: HG15315-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"