ST3GAL4 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG13527-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ST3GAL4 Reagents
CRO Services
Product recommended

All ST3GAL4 Reagents
ST3GAL4 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1041 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human ST3 beta-galactoside alpha-2,3-sialyltransferase 4 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Restriction Sites
KpnI + XbaI(6kb+1.04kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
ST3GAL4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ST3GAL4 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Human aFGF/FGF1 Gene Plasmid Map 5637
ST3GAL4 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
CGS23 cDNA ORF Clone, Human;NANTA3 cDNA ORF Clone, Human;SAT3 cDNA ORF Clone, Human;SIAT4 cDNA ORF Clone, Human;SIAT4C cDNA ORF Clone, Human;ST3GalIV cDNA ORF Clone, Human;STZ cDNA ORF Clone, Human
ST3GAL4 Background Information
Full Name
ST3 beta-galactoside alpha-2,3-sialyltransferase 4

ST3GAL4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ST3GAL4 cDNA ORF Clone in Cloning Vector, Mouse MG59759-U
ST3GAL4 cDNA ORF Clone, Mouse, untagged MG59759-UT
ST3GAL4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59759-ACG
ST3GAL4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59759-ACGLN
ST3GAL4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59759-ANG
ST3GAL4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59759-ACR
ST3GAL4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59759-ANR
ST3GAL4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59759-CF
ST3GAL4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59759-NF
ST3GAL4 cDNA ORF Clone, Mouse, C-His tag MG59759-CH
ST3GAL4 cDNA ORF Clone, Mouse, N-His tag MG59759-NH
ST3GAL4 cDNA ORF Clone, Mouse, C-HA tag MG59759-CY
ST3GAL4 cDNA ORF Clone, Mouse, N-HA tag MG59759-NY
ST3GAL4 cDNA ORF Clone, Mouse, C-Myc tag MG59759-CM
ST3GAL4 cDNA ORF Clone, Mouse, N-Myc tag MG59759-NM

ST3GAL4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ST3GAL4 cDNA ORF Clone in Cloning Vector, Human HG13527-G
ST3GAL4 cDNA ORF Clone, Human, untagged HG13527-UT
ST3GAL4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13527-ACGLN
ST3GAL4 cDNA ORF Clone, Human, C-GFPSpark® tag HG13527-ACG
ST3GAL4 cDNA ORF Clone, Human, C-OFPSpark® tag HG13527-ACR
ST3GAL4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13527-CF
ST3GAL4 cDNA ORF Clone, Human, C-His tag HG13527-CH
ST3GAL4 cDNA ORF Clone, Human, N-His tag HG13527-NH
ST3GAL4 cDNA ORF Clone, Human, C-HA tag HG13527-CY
ST3GAL4 cDNA ORF Clone, Human, N-HA tag HG13527-NY
ST3GAL4 cDNA ORF Clone, Human, C-Myc tag HG13527-CM
ST3GAL4 cDNA ORF Clone, Human, N-Myc tag HG13527-NM
ST3GAL4 qPCR Primer Pairs, Human HP102213
info info
添加购物车成功! 添加购物车失败!