ST3GAL1 cDNA ORF Clone, Human, untagged

Cat: HG13369-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ST3GAL1 Reagents
CRO Services
Product recommended

All ST3GAL1 Reagents
ST3GAL1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1023 bp
Description
Full length Clone DNA of Human ST3 beta-galactoside alpha-2,3-sialyltransferase 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ST3GAL1 cDNA ORF Clone, Human, untagged Alternative Names
Gal-NAc6S cDNA ORF Clone, Human;SIAT4A cDNA ORF Clone, Human;SIATFL cDNA ORF Clone, Human;ST3GalA cDNA ORF Clone, Human;ST3GalA.1 cDNA ORF Clone, Human;ST3GalIA cDNA ORF Clone, Human;ST3GalIA,1 cDNA ORF Clone, Human;ST3O cDNA ORF Clone, Human
ST3GAL1 Background Information
Full Name
ST3 beta-galactoside alpha-2,3-sialyltransferase 1

ST3GAL1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ST3GAL1 cDNA ORF Clone in Cloning Vector, Mouse MG5A7314-U
ST3GAL1 cDNA ORF Clone, Mouse, untagged MG5A7314-UT
ST3GAL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7314-ACG
ST3GAL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7314-ACGLN
ST3GAL1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A7314-ANG
ST3GAL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A7314-ACR
ST3GAL1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A7314-ANR
ST3GAL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A7314-CF
ST3GAL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A7314-NF
ST3GAL1 cDNA ORF Clone, Mouse, C-His tag MG5A7314-CH
ST3GAL1 cDNA ORF Clone, Mouse, N-His tag MG5A7314-NH
ST3GAL1 cDNA ORF Clone, Mouse, C-HA tag MG5A7314-CY
ST3GAL1 cDNA ORF Clone, Mouse, N-HA tag MG5A7314-NY
ST3GAL1 cDNA ORF Clone, Mouse, C-Myc tag MG5A7314-CM
ST3GAL1 cDNA ORF Clone, Mouse, N-Myc tag MG5A7314-NM

ST3GAL1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ST3GAL1 cDNA ORF Clone in Cloning Vector, Human HG13369-G
ST3GAL1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13369-ACG
ST3GAL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13369-ACGLN
ST3GAL1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13369-ACR
ST3GAL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13369-CF
ST3GAL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13369-NF
ST3GAL1 cDNA ORF Clone, Human, C-His tag HG13369-CH
ST3GAL1 cDNA ORF Clone, Human, N-His tag HG13369-NH
ST3GAL1 cDNA ORF Clone, Human, C-HA tag HG13369-CY
ST3GAL1 cDNA ORF Clone, Human, N-HA tag HG13369-NY
ST3GAL1 cDNA ORF Clone, Human, C-Myc tag HG13369-CM
ST3GAL1 cDNA ORF Clone, Human, N-Myc tag HG13369-NM
ST3GAL1 qPCR Primer Pairs, Human HP102074
info info
添加购物车成功! 添加购物车失败!